Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SLPI-secretory leukocyte peptidase inhibitor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLPI-secretory leukocyte peptidase inhibitor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020708 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLPI |
| Origin species: | Human |
| Product name: | SLPI-secretory leukocyte peptidase inhibitor Gene |
| Size: | 2ug |
| Accessions: | BC020708 |
| Gene id: | 6590 |
| Gene description: | secretory leukocyte peptidase inhibitor |
| Synonyms: | ALK1; ALP; BLPI; HUSI; HUSI-I; MPI; WAP4; WFDC4; antileukoproteinase; HUSI-1; WAP four-disulfide core domain protein 4; mucus proteinase inhibitor; protease inhibitor WAP4; secretory leukocyte protease inhibitor (antileukoproteinase); seminal proteinase inhibitor; secretory leukocyte peptidase inhibitor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtccagcggcctcttccccttcctggtgctgcttgccctgggaactctggcaccttgggctgtggaaggctctggaaagtccttcaaagctggagtctgtcctcctaagaaatctgcccagtgccttagatacaagaaacctgagtgccagagtgactggcagtgtccagggaagaagagatgttgtcctgacacttgtggcatcaaatgcctggatcctgttgacaccccaaacccaacaaggaggaagcctgggaagtgcccagtgacttatggccaatgtttgatgcttaacccccccaatttctgtgagatggatggccagtgcaagcgtgacttgaagtgttgcatgggcatgtgtgggaaatcctgcgtttcccctgtgaaagcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 11 open reading frame 30 - chromosome 11 open reading frame 17 - transmembrane 4 L six family member 1 - chromosome 10 open reading frame 78 |