PTXBC020843
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020843 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HAVCR2 |
| Origin species: | Human |
| Product name: | HAVCR2-hepatitis A virus cellular receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC020843 |
| Gene id: | 84868 |
| Gene description: | hepatitis A virus cellular receptor 2 |
| Synonyms: | CD366; HAVcr-2; KIM-3; TIM3; TIMD-3; TIMD3; Tim-3; hepatitis A virus cellular receptor 2; T cell immunoglobulin mucin 3; T-cell immunoglobulin and mucin domain-containing protein 3; T-cell immunoglobulin mucin family member 3; T-cell immunoglobulin mucin receptor 3; T-cell membrane protein 3; kidney injury molecule-3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttttcacatcttccctttgactgtgtcctgctgctgctgctgctactacttacaaggtcctcagaagtggaatacagagcggaggtcggtcagaatgcctatctgccctgcttctacaccccagccgccccagggaacctcgtgcccgtctgctggggcaaaggagcctgtcctgtgtttgaatgtggcaacgtggtgctcaggactgatgaaagggatgtgaattattggacatccagatactggctaaatggggatttccgcaaaggagatgtgtccctgaccatagagaatgtgactctagcagacagtgggatctactgctgccggatccaaatcccaggcataatgaatgatgaaaaatttaacctgaagttggtcatcaaaccaggtgagtggacatttgcatgccatctttatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 16 open reading frame 63 - chromosome 10 open reading frame 97 - glycoprotein hormones, alpha polypeptide - chromosome 1 open reading frame 162 |