Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PLA2G4C-phospholipase A2, group IVC (cytosolic, calcium-independent) Gene
PTXBC017956
New product
Data sheet of PLA2G4C-phospholipase A2, group IVC (cytosolic, calcium-independent) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G4C-phospholipase A2, group IVC (cytosolic, calcium-independent) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017956 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G4C |
| Origin species: | Human |
| Product name: | PLA2G4C-phospholipase A2, group IVC (cytosolic, calcium-independent) Gene |
| Size: | 2ug |
| Accessions: | BC017956 |
| Gene id: | 8605 |
| Gene description: | phospholipase A2, group IVC (cytosolic, calcium-independent) |
| Synonyms: | CPLA2-gamma; cytosolic phospholipase A2 gamma; phospholipase A2, group IVC (cytosolic, calcium-independent); phospholipase A2 group IVC |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaagctctgaagtttccataattcctgggctccagaaagaagaaaaggcggccgtggagagacgaagacttcatgtgctgaaagctctgaagaagctaaggattgaggctgatgaggccccagttgttgctgtgctgggctcaggcggaggactgcgggctcacattgcctgccttggggtcctgagtgagatgaaagaacagggcctgttggatgccgtcacgtacctcgcaggggtctctggatccacttgggcaatatcttctctctacaccaatgatggtgacatggaagctctcgaggctgacctgaaacatcgatttacccgacaggagtgggacttggctaagagcctacagaaaaccatccaagcagcgaggtctgagaattactctctgaccgacttctgggcctacatggttatctctaagcaaaccagagaactgccggagtctcatttgtccaatatgaagaagcccgtggaagaagggacactaccctacccaatatttgcagccattgacaatgacctgcaaccttcctggcaggaggcaagagcaccaggtaagcaaacatttagagggagggagaggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase, non-receptor type 22 (lymphoid) - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) |