PTXBC069503
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069503 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CER1 |
| Origin species: | Human |
| Product name: | CER1-cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC069503 |
| Gene id: | 9350 |
| Gene description: | cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) |
| Synonyms: | DAND4; cerberus; DAN domain family member 4; cerberus 1, cysteine knot superfamily, homolog; cerberus-related 1; cerberus-related protein; cerberus 1, DAN family BMP antagonist |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatctcctcttatttcagctgctggtactcctgcctctaggaaagaccacatggcaccaggatggccgccagaatcagagttctctttcccccgtactcctgccaaggaatcaaagagagcttcccacaggcaaccatgaggaagctgaggagaagccagatctgcttgtcgcagtgccacaccttgtaggcaccagccctgcaggggaaggccagaggcagagagagaagatgctgtccagatttggcaggttctggaagaagcctgagagagaaatgcatccatccagggactcagatagtgagcccttcccacctgggacccagtccctcatccagccgatagatggaatgaaaatggagaaatctcctcttcgggaagaagccaagaaattctggcaccacttcatgttcagaaaaactccggcttctcagggggtcatcttgcccatcaaaagccatgaagtacattgggagacctgcaggacagtgcccttcagccagactataacccacgaaggctgtgaaaaaatagttgttcagaacaacctttgctttgggaaatgcgggtctgttcattttcctggagccgcgcagcactcccatacctcctgctctcactgtttgcctgccaagttcaccacgatgcacttgccactgaactgcactgaactttcctccgtgatcaaggtggtgatgctggtggaggagtgccagtgcaaggtgaagacggagcatgaagatggacacatcctacatgctggctcccaggattcctttatcccaggagtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - serpin peptidase inhibitor, clade B (ovalbumin), member 11 - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 - Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) |