Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB11-serpin peptidase inhibitor, clade B (ovalbumin), member 11 Gene
PTXBC069596
New product
Data sheet of SERPINB11-serpin peptidase inhibitor, clade B (ovalbumin), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB11-serpin peptidase inhibitor, clade B (ovalbumin), member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069596 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB11 |
| Origin species: | Human |
| Product name: | SERPINB11-serpin peptidase inhibitor, clade B (ovalbumin), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC069596 |
| Gene id: | 89778 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 11 |
| Synonyms: | EPIPIN; SERPIN11; serpin B11; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11; serpin peptidase inhibitor, clade B (ovalbumin), member 11; serpin family B member 11 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggttctctcagcacagctaacgttgaattttgccttgatgtgttcaaagagctgaacagtaacaacataggagataacatcttcttttcttcgctgagtctgctttatgctctaagcatggtcctccttggtgccaggggagagactgcagagcaattggagaaggtgcttcattttagtcatactgtagactcattaaaaccagggttcaaggactcacctaagtgcagccaagctggaagaattcattccgagtttggtgtcgaattctctcaaatcaaccagccagactctaactgtaccctcagcattgccaacaggctctacgggacaaagacgatggcatttcatcagcaatatttaagctgttctgagaaatggtatcaagccaggttgcaaactgtggattttgaacagtctacagaagaaacgaggaaaatgattaatgcttgggttgaaaataaaactaatggaaaagtcgcaaatctctttggaaagagcacaattgacccttcatctgtaatggtcctggtgaataccatatatttcaaaggacaaaggcaaaataaatttcaagtaagagagacagttaaaagtccttttcagctaagtgaaggtaaaaatgtaactgtggaaatgatgtatcaaattggaacatttaaactggcctttgtaaaggagccgcagatgcaagttcttgagctgccctacgttaacaacaaattaagcatgattattctgcttccagtaggcatagctaatctgaaacagatagaaaagcagctgaattcggggacgtttcatgagtggacaagctcttctaacatgatggaaagagaagttgaagtacacctccccagattcaaacttgaaattaagtatgagctaaattccctgttaaaacctctaggggtgacagatctcttcaaccaggtcaaagctgatctttctggaatgtcaccaaccaagggcctatatttatcaaaagctatccacaagtcatacctggatgtcagcgaagagggcacggaggcagcagcagccactggggacagcatcgctgtaaaaagcctaccaatgagagctcagttcaaggcgaaccaccccttcctgttctttataaggcacactcataccaacacgatcctattctgtggcaagcttgcctctccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 - Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) - phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 |