Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTPN22-protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene
PTXBC017785
New product
Data sheet of PTPN22-protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN22-protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017785 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN22 |
| Origin species: | Human |
| Product name: | PTPN22-protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene |
| Size: | 2ug |
| Accessions: | BC017785 |
| Gene id: | 26191 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 22 (lymphoid) |
| Synonyms: | LYP; LYP1; LYP2; PEP; PTPN8; tyrosine-protein phosphatase non-receptor type 22; PEST-domain phosphatase; hematopoietic cell protein-tyrosine phosphatase 70Z-PEP; lymphoid-specific protein tyrosine phosphatase; protein tyrosine phosphatase, non-receptor type 22 (lymphoid); protein tyrosine phosphatase, non-receptor type 8; protein tyrosine phosphatase, non-receptor type 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccaaagagaaattctgcagaagttcctggatgaggcccaaagcaagaaaattactaaagaggagtttgccaatgaatttctgaagctgaaaaggcaatctaccaagtacaaggcagacaaaacctatcctacaactgtggctgagaagcccaagaatatcaagaaaaacagatataaggatattttgccctatgattatagccgggtagaactatccctgataacctctgatgaggattccagctacatcaatgccaacttcattaagggagtttatggacccaaggcttatattgccacccagggtcctttatctacaaccctcctggacttctggaggatgatttgggaatatagtgtccttatcattgttatggcatgcatggagtatgaaatgggaaaggaagctgaaaaaaggaaatctgattatataatcaggactctaaaagttaagttcaatagtgtatctgtaattcttgcccaccaaacaagcctgcagaatctgttcagtcaaataactccagctcatttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) |