Login to display prices
Login to display prices
ING2-inhibitor of growth family, member 2 Gene View larger

ING2-inhibitor of growth family, member 2 Gene

PTXBC030128

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ING2-inhibitor of growth family, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ING2-inhibitor of growth family, member 2 Gene

Proteogenix catalog: PTXBC030128
Ncbi symbol: ING2
Product name: ING2-inhibitor of growth family, member 2 Gene
Size: 2ug
Accessions: BC030128
Gene id: 3622
Gene description: inhibitor of growth family, member 2
Synonyms: ING1L; p33ING2; inhibitor of growth protein 2; ING1Lp; inhibitor of growth 1-like protein; p32; inhibitor of growth family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttagggcagcagcagcagcaactgtactcgtcggctgcgctcctgaccggggagcggagccggctgctcacctgctacgtgcaggactaccttgagtgcgtggagtcgctgccccacgacatgcagaggaacgtgtctgtgctgcgagagctggacaacaaatatcaagaaacgttaaaggaaattgatgatgtctacgaaaaatataagaaagaagatgatttaaaccagaagaaacgtctacagcagcttctccagagagcactaattaatagtcaagaattgggagatgaaaaaatacagattgttacacaaatgctcgaattggtggaaaatcgggcaagacaaatggagttacactcacagtgtttccaagatcctgctgaaagtgaacgagcctcagataaagcaaagatggattccagccaaccagaaagatcttcaagaagaccccgcaggcagcggaccagtgaaagccgtgatttatgtcacatggcaaatgggattgaagactgtgatgatcagccacctaaagaaaagaaatccaagtcagcaaagaaaaagaaacgctccaaggccaagcaggaaagggaagcttcacctgttgagtttgcaatagatcctaatgaacctacatactgcttatgcaaccaagtgtcttatggggagatgataggatgtgacaatgaacagtgtccaattgaatggtttcacttttcatgtgtttcacttacctataaaccaaaggggaaatggtattgcccaaagtgcaggggagataatgagaaaacaatggacaaaagtactgaaaagacaaaaaaggatagaagatcgaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: