Login to display prices
Login to display prices
NUP62CL-nucleoporin 62kDa C-terminal like Gene View larger

NUP62CL-nucleoporin 62kDa C-terminal like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUP62CL-nucleoporin 62kDa C-terminal like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUP62CL-nucleoporin 62kDa C-terminal like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017799
Product type: DNA & cDNA
Ncbi symbol: NUP62CL
Origin species: Human
Product name: NUP62CL-nucleoporin 62kDa C-terminal like Gene
Size: 2ug
Accessions: BC017799
Gene id: 54830
Gene description: nucleoporin 62kDa C-terminal like
Synonyms: nucleoporin-62 C-terminal-like protein; nucleoporin 62kDa C-terminal like; nucleoporin 62 C-terminal like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtttacctcaatatcaaattctttgacctccactgctgctattgggctctcatttacaacttcaacgactaccaccgccactttcaccaccaacactactaccacaatcaccagtggctttactgtgaaccaaaaccaactgttatcaagagggtttgaaaaccttgtaccttatacttcaactgttagattcgtattttacatggagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - amidohydrolase domain containing 2
- primase, DNA, polypeptide 2 (58kDa)
- ribosomal protein SA pseudogene
- immunoglobulin kappa variable 1-5