CRP-C-reactive protein, pentraxin-related Gene View larger

CRP-C-reactive protein, pentraxin-related Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRP-C-reactive protein, pentraxin-related Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRP-C-reactive protein, pentraxin-related Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020766
Product type: DNA & cDNA
Ncbi symbol: CRP
Origin species: Human
Product name: CRP-C-reactive protein, pentraxin-related Gene
Size: 2ug
Accessions: BC020766
Gene id: 1401
Gene description: C-reactive protein, pentraxin-related
Synonyms: PTX1; C-reactive protein; C-reactive protein, pentraxin-related; pentraxin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacacggaactgtcctcgacccgtggtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 62kDa C-terminal like
- amidohydrolase domain containing 2
- primase, DNA, polypeptide 2 (58kDa)
- ribosomal protein SA pseudogene

Buy CRP-C-reactive protein, pentraxin-related Gene now

Add to cart