KCTD9-potassium channel tetramerisation domain containing 9 Gene View larger

KCTD9-potassium channel tetramerisation domain containing 9 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD9-potassium channel tetramerisation domain containing 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD9-potassium channel tetramerisation domain containing 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021216
Product type: DNA & cDNA
Ncbi symbol: KCTD9
Origin species: Human
Product name: KCTD9-potassium channel tetramerisation domain containing 9 Gene
Size: 2ug
Accessions: BC021216
Gene id: 54793
Gene description: potassium channel tetramerisation domain containing 9
Synonyms: BTB/POZ domain-containing protein KCTD9; BTBD27; potassium channel tetramerisation domain containing 9; potassium channel tetramerization domain containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcgggtgaccctgttcctgaacggcagccccaagaacggaaaggtggttgctgtatatggaactttatctgatttgctttctgtggccagcagtaaactcggcataaaagccaccagtgtgtataatgggaaaggtggactgattgatgatattgctttgatcagggatgatgatgttttgtttgtttgtgaaggagagccatttattgatcctcagacagattctaagcctcctgagggattgttaggattccacacagactggctgacattaaatgttggagggcggtactttacaactacacggagcactttagtgaataaagaacctgacagtatgctggcccacatgtttaaggacaaaggtgtctggggaaataagcaagatcatagaggagctttcttaattgaccgaagtcctgagtacttcgaacccattttgaactacttgcgtcatggacagctcattgtaaatgatggcattaatttattgggtgtgttagaagaagcaagattttttggtattgactcattgattgaacacctagaagtggcaataaagaattctcaaccaccggaggatcattcaccaatatcccgaaaggaatttgtccgatttttgctagcaactccaaccaagtcagaactgcgatgccagggtttgaacttcagtggtgctgatctttctcgtttggaccttcgatacattaacttcaaaatggccaatttaagccgctgtaatcttgcacatgcaaatctttgctgtgcaaatcttgaacgagctgatctctctggatcagtgcttgactgtgcgaatctccagggagtcaagatgctctgttctaatgcagaaggagcatccctgaaactgtgtaattttgaggatccttctggtcttaaagccaatttagaaggtgctaatctgaaaggtgtggatatggaaggaagtcagatgacaggaattaacctgagagtggctaccttaaaaaatgcaaagttgaagaactgtaacctcagaggagcaactctggcaggaactgatttagagaattgtgatctgtctgggtgtgatcttcaagaagccaacctgagagggtccaacgtgaagggagctatatttgaagagatgctgacaccactacacatgtcacaaagtgtcagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - olfactory receptor, family 51, subfamily E, member 2
- potassium channel tetramerisation domain containing 6
- proteasome (prosome, macropain) subunit, beta type, 1
- lymphotoxin beta receptor (TNFR superfamily, member 3)

Buy KCTD9-potassium channel tetramerisation domain containing 9 Gene now

Add to cart