Login to display prices
Login to display prices
OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene View larger

OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene

PTXBC020768

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene

Proteogenix catalog: PTXBC020768
Ncbi symbol: OR51E2
Product name: OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene
Size: 2ug
Accessions: BC020768
Gene id: 81285
Gene description: olfactory receptor, family 51, subfamily E, member 2
Synonyms: OR51E3P; OR52A2; olfactory receptor 51E2; HPRAJ; olfactory receptor OR11-16; olfactory receptor, family 51, subfamily E, member 3 pseudogene; olfactory receptor, family 52, subfamily A, member 2; prostate-specific G-protein coupled receptor; olfactory receptor family 51 subfamily E member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttcctgcaacttcacacatgccacctttgtgcttattggtatcccaggattagagaaagcccatttctgggttggcttccccctcctttccatgtatgtagtggcaatgtttggaaactgcatcgtggtcttcatcgtaaggacggaacgcagcctgcacgctccgatgtacctctttctctgcatgcttgcagccattgacctggccttatccacatccaccatgcctaagatccttgcccttttctggtttgattcccgagagattagctttgaggcctgtcttacccagatgttctttattcatgccctctcagccattgaatccaccatcctgctggccatggcctttgaccgttatgtggccatctgccacccactgcgccatgctgcagtgctcaacaatacagtaacagcccagattggcatcgtggctgtggtccgcggatccctcttttttttcccactgcctctgctgatcaagcggctggccttctgccactccaatgtcctctcgcactcctattgtgtccaccaggatgtaatgaagttggcctatgcagacactttgcccaatgtggtatatggtcttactgccattctgctggtcatgggcgtggacgtaatgttcatctccttgtcctattttctgataatacgaacggttctgcaactgccttccaagtcagagcgggccaaggcctttggaacctgtgtgtcacacattggtgtggtactcgccttctatgtgccacttattggcctctcagttgtacaccgctttggaaacagccttcatcccattgtgcgtgttgtcatgggtgacatctacctgctgctgcctcctgtcatcaatcccatcatctatggtgccaaaaccaaacagatcagaacacgggtgctggctatgttcaagatcagctgtgacaaggacttgcaggctgtgggaggcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: