Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene
PTXBC020768
New product
Data sheet of OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020768 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR51E2 |
| Origin species: | Human |
| Product name: | OR51E2-olfactory receptor, family 51, subfamily E, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC020768 |
| Gene id: | 81285 |
| Gene description: | olfactory receptor, family 51, subfamily E, member 2 |
| Synonyms: | OR51E3P; OR52A2; olfactory receptor 51E2; HPRAJ; olfactory receptor OR11-16; olfactory receptor, family 51, subfamily E, member 3 pseudogene; olfactory receptor, family 52, subfamily A, member 2; prostate-specific G-protein coupled receptor; olfactory receptor family 51 subfamily E member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagttcctgcaacttcacacatgccacctttgtgcttattggtatcccaggattagagaaagcccatttctgggttggcttccccctcctttccatgtatgtagtggcaatgtttggaaactgcatcgtggtcttcatcgtaaggacggaacgcagcctgcacgctccgatgtacctctttctctgcatgcttgcagccattgacctggccttatccacatccaccatgcctaagatccttgcccttttctggtttgattcccgagagattagctttgaggcctgtcttacccagatgttctttattcatgccctctcagccattgaatccaccatcctgctggccatggcctttgaccgttatgtggccatctgccacccactgcgccatgctgcagtgctcaacaatacagtaacagcccagattggcatcgtggctgtggtccgcggatccctcttttttttcccactgcctctgctgatcaagcggctggccttctgccactccaatgtcctctcgcactcctattgtgtccaccaggatgtaatgaagttggcctatgcagacactttgcccaatgtggtatatggtcttactgccattctgctggtcatgggcgtggacgtaatgttcatctccttgtcctattttctgataatacgaacggttctgcaactgccttccaagtcagagcgggccaaggcctttggaacctgtgtgtcacacattggtgtggtactcgccttctatgtgccacttattggcctctcagttgtacaccgctttggaaacagccttcatcccattgtgcgtgttgtcatgggtgacatctacctgctgctgcctcctgtcatcaatcccatcatctatggtgccaaaaccaaacagatcagaacacgggtgctggctatgttcaagatcagctgtgacaaggacttgcaggctgtgggaggcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel tetramerisation domain containing 6 - proteasome (prosome, macropain) subunit, beta type, 1 - lymphotoxin beta receptor (TNFR superfamily, member 3) - UDP glucuronosyltransferase 2 family, polypeptide B4 |