Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LTBR-lymphotoxin beta receptor (TNFR superfamily, member 3) Gene
PTXBC026262
New product
Data sheet of LTBR-lymphotoxin beta receptor (TNFR superfamily, member 3) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LTBR-lymphotoxin beta receptor (TNFR superfamily, member 3) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026262 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LTBR |
| Origin species: | Human |
| Product name: | LTBR-lymphotoxin beta receptor (TNFR superfamily, member 3) Gene |
| Size: | 2ug |
| Accessions: | BC026262 |
| Gene id: | 4055 |
| Gene description: | lymphotoxin beta receptor (TNFR superfamily, member 3) |
| Synonyms: | CD18; D12S370; LT-BETA-R; TNF-R-III; TNFCR; TNFR-RP; TNFR2-RP; TNFR3; TNFRSF3; tumor necrosis factor receptor superfamily member 3; lymphotoxin B receptor; lymphotoxin beta receptor (TNFR superfamily, member 3); tumor necrosis factor C receptor; tumor necrosis factor receptor 2-related protein; tumor necrosis factor receptor type III |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctgccttgggccacctctgcccccggcctggcctgggggcctctggtgctgggcctcttcgggctcctggcagcatcgcagccccaggcggtgcctccatatgcgtcggagaaccagacctgcagggaccaggaaaaggaatactatgagccccagcaccgcatctgctgctcccgctgcccgccaggcacctatgtctcagctaaatgtagccgcatccgggacacagtttgtgccacatgtgccgagaattcctacaacgagcactggaactacctgaccatctgccagctgtgccgcccctgtgacccagtgatgggcctcgaggagattgccccctgcacaagcaaacggaagacccagtgccgctgccagccgggaatgttctgtgctgcctgggccctcgagtgtacacactgcgagctactttctgactgcccgcctggcactgaagccgagctcaaagatgaagttgggaagggtaacaaccactgcgtcccctgcaaggccgggcacttccagaatacctcctcccccagcgcccgctgccagccccacaccaggtgtgagaaccaaggtctggtggaggcagctccaggcactgcccagtccgacacaacctgcaaaaatccattagagccactgcccccagagatgtcaggaaccatgctgatgctggccgttctgctgccactggccttctttctgctccttgccaccgtcttctcctgcatctggaagagccacccttctctctgcaggaaactgggatcgctgctcaagaggcgtccgcagggagagggacccaatcctgtagctggaagctgggagcctccgaaggcccatccatacttccctgacttggtacagccactgctacccatttctggagatgtttccccagtatccactgggctccccgcagccccagttttggaggcaggggtgccgcaacagcagagtcctctggacctgaccagggagccgcagttggaacccggggagcagagccaggtggcccacggtaccaatggcattcatgtcaccggcgggtctatgactatcactggcaacatctacatctacaatggaccagtactggggggaccaccgggtcctggagacctcccagctacccccgaacctccataccccattcccgaagagggggaccctggccctcccgggctctctacaccccaccaggaagatggcaaggcttggcacctagcggagacagagcactgtggtgccacaccctctaacaggggcccaaggaaccaatttatcacccatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP glucuronosyltransferase 2 family, polypeptide B4 - UDP glucuronosyltransferase 2 family, polypeptide B7 - UDP glucuronosyltransferase 1 family, polypeptide A9 - V-set domain containing T cell activation inhibitor 1 |