Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VTCN1-V-set domain containing T cell activation inhibitor 1 Gene
PTXBC065717
New product
Data sheet of VTCN1-V-set domain containing T cell activation inhibitor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VTCN1-V-set domain containing T cell activation inhibitor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VTCN1 |
| Origin species: | Human |
| Product name: | VTCN1-V-set domain containing T cell activation inhibitor 1 Gene |
| Size: | 2ug |
| Accessions: | BC065717 |
| Gene id: | 79679 |
| Gene description: | V-set domain containing T cell activation inhibitor 1 |
| Synonyms: | B7-H4; B7H4; B7S1; B7X; B7h.5; PRO1291; VCTN1; V-set domain-containing T-cell activation inhibitor 1; B7 family member, H4; B7 homolog 4; B7 superfamily member 1; T cell costimulatory molecule B7x; immune costimulatory protein B7-H4; V-set domain containing T cell activation inhibitor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcagaggccggacagcagtgtttgctgatcaagtgatagttggcaatgcctctttgcggctgaaaaacgtgcaactcacagatgctggcacctacaaatgttatatcatcacttctaaaggcaaggggaatgctaaccttgagtataaaactggagccttcagcatgccggaagtgaatgtggactataatgccagctcagagaccttgcggtgtgaggctccccgatggttcccccagcccacagtggtctgggcatcccaagttgaccagggagccaacttctcggaagtctccaataccagctttgagctgaactctgagaatgtgaccatgaaggttgtgtctgtgctctacaatgttacgatcaacaacacatactcctgtatgattgaaaatgacattgccaaagcaacaggggatatcaaagtgacagaatcggagatcaaaaggcggagtcacctacagctgctaaactcaaaggcttctctgtgtgtctcttctttctttgccatcagctgggcacttctgcctctcagcccttacctgatgctaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family member 6 - wingless-type MMTV integration site family, member 7B - G protein-coupled receptor kinase interacting ArfGAP 1 - ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide |