RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene View larger

RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene

PTXBC032135

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032135
Product type: DNA & cDNA
Ncbi symbol: RPUSD3
Origin species: Human
Product name: RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene
Size: 2ug
Accessions: BC032135
Gene id: 285367
Gene description: RNA pseudouridylate synthase domain containing 3
Synonyms: RNA pseudouridylate synthase domain-containing protein 3; RNA pseudouridylate synthase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggccgccgtgttttgggccggttctggagtggctggcggcggggcctgggtgtccgcccagtgcccgaggacgcaggctttggcaccgaagcccggcatcagaggcaaccccgcggctcctgccaacggtcggggcccctcggggaccagcccttcgcggggctgctgccaaaaaacctcagtcgggaggagctggttgatgcgctgcgggcagccgtggtggaccggaaaggacctctagtgacgttgaacaagccacagggtctaccagtgacaggaaaaccaggagagctgacgttgttctcagtgctgccagagctgagccagtccctagggctcagggagcaggagcttcaggttgtccgagcatctgggaaagaaagctctgggcttgtactcctctccagctgtccccagacagctagtcgcctccagaagtacttcacccatgcacggagagcccaaaggcccacagccacctactgtgctgtcactgatgggatcccagctgcttctgaggggaagatccaggctgccctgaaactggaacacattgatggggtcaatctcacagttccagtgaaggccccatcccgaaaggacatcctggaaggtgtcaagaagactctcagtcactttcgtgtggtagccacaggctctggctgtgccctggtccagctgcagccactgacagtgttctccagtcaactacaggtgcacatggtactacagctctgccctgtgcttggggaccacatgtactctgcccgtgtgggcactgtcctgggccagcgatttctgctgccagctgagaacaacaagccccaaagacaggtcctggatgaagccctcctcagacgcctccacctgaccccctcccaggctgcccagctgcccttgcacctccacctacatcggctccttctcccaggcaccagggccagggacacccctgttgagctcctggcaccactgcccccttatttctccaggaccctacagtgcctggggctccgcttacaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fumarylacetoacetate hydrolase domain containing 1
- centrobin, centrosomal BRCA2 interacting protein
- vesicle-associated membrane protein 5 (myobrevin)
- radical S-adenosyl methionine domain containing 2

Buy RPUSD3-RNA pseudouridylate synthase domain containing 3 Gene now

Add to cart