Cart 9 Product Products 1 708,72 € (empty)
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 708,72 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 708,72 €
View larger 
VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
PTXBC017891
New product
Data sheet of VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017891 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP5 |
| Origin species: | Human |
| Product name: | VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene |
| Size: | 2ug |
| Accessions: | BC017891 |
| Gene id: | 10791 |
| Gene description: | vesicle-associated membrane protein 5 (myobrevin) |
| Synonyms: | vesicle-associated membrane protein 5; VAMP-5; myobrevin; vesicle associated membrane protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggaatagagttggagcggtgccagcagcaggcgaacgaggtgacggaaattatgcgtaacaacttcggcaaggtcctggagcgtggtgtgaagctggccgaactgcagcagcgttcagaccaactcctggatatgagctcaaccttcaacaagactacacagaacctggcccagaagaagtgctgggagaacatccgttaccggatctgcgtggggctggtggtggttggtgtcctgctcatcatcctgattgtgctgctggtcgtctttctccctcagagcagtgacagcagtagtgccccacggacccaggatgcaggcattgcctcagggcctgggaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - radical S-adenosyl methionine domain containing 2 - alcohol dehydrogenase 4 (class II), pi polypeptide - RNA pseudouridylate synthase domain containing 3 - upstream transcription factor 2, c-fos interacting |