Login to display prices
Login to display prices
FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene View larger

FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

PTXBC020615

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

Proteogenix catalog: PTXBC020615
Ncbi symbol: FAHD1
Product name: FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene
Size: 2ug
Accessions: BC020615
Gene id: 81889
Gene description: fumarylacetoacetate hydrolase domain containing 1
Synonyms: acylpyruvase FAHD1, mitochondrial; C16orf36; YISKL; FAH domain-containing protein 1; OAA decarboxylase; YISK like/RJD15; acylpyruvate hydrolase; fumarylacetoacetate hydrolase domain-containing protein 1; oxaloacetate decarboxylase; yisK-like protein; fumarylacetoacetate hydrolase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccagataactttccgttgtttaccaaattttcttagatttggtcatcatcaggaagcatttgtaaaaataaaaatctccacaaattactggcccatctcggacttgctgaatcaatttgataggattaatctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: