FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene View larger

FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

PTXBC020615

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020615
Product type: DNA & cDNA
Ncbi symbol: FAHD1
Origin species: Human
Product name: FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene
Size: 2ug
Accessions: BC020615
Gene id: 81889
Gene description: fumarylacetoacetate hydrolase domain containing 1
Synonyms: acylpyruvase FAHD1, mitochondrial; C16orf36; YISKL; FAH domain-containing protein 1; OAA decarboxylase; YISK like/RJD15; acylpyruvate hydrolase; fumarylacetoacetate hydrolase domain-containing protein 1; oxaloacetate decarboxylase; yisK-like protein; fumarylacetoacetate hydrolase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccagataactttccgttgtttaccaaattttcttagatttggtcatcatcaggaagcatttgtaaaaataaaaatctccacaaattactggcccatctcggacttgctgaatcaatttgataggattaatctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrobin, centrosomal BRCA2 interacting protein
- vesicle-associated membrane protein 5 (myobrevin)
- radical S-adenosyl methionine domain containing 2
- alcohol dehydrogenase 4 (class II), pi polypeptide

Buy FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene now

Add to cart