Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene
PTXBC020615
New product
Data sheet of FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020615 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAHD1 |
| Origin species: | Human |
| Product name: | FAHD1-fumarylacetoacetate hydrolase domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC020615 |
| Gene id: | 81889 |
| Gene description: | fumarylacetoacetate hydrolase domain containing 1 |
| Synonyms: | acylpyruvase FAHD1, mitochondrial; C16orf36; YISKL; FAH domain-containing protein 1; OAA decarboxylase; YISK like/RJD15; acylpyruvate hydrolase; fumarylacetoacetate hydrolase domain-containing protein 1; oxaloacetate decarboxylase; yisK-like protein; fumarylacetoacetate hydrolase domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccagataactttccgttgtttaccaaattttcttagatttggtcatcatcaggaagcatttgtaaaaataaaaatctccacaaattactggcccatctcggacttgctgaatcaatttgataggattaatctccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrobin, centrosomal BRCA2 interacting protein - vesicle-associated membrane protein 5 (myobrevin) - radical S-adenosyl methionine domain containing 2 - alcohol dehydrogenase 4 (class II), pi polypeptide |