DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene View larger

DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024290
Product type: DNA & cDNA
Ncbi symbol: DNTTIP1
Origin species: Human
Product name: DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene
Size: 2ug
Accessions: BC024290
Gene id: 116092
Gene description: deoxynucleotidyltransferase, terminal, interacting protein 1
Synonyms: C20orf167; Tdif1; dJ447F3.4; deoxynucleotidyltransferase terminal-interacting protein 1; TdT binding protein; tdT-interacting factor 1; terminal deoxynucleotidyltransferase-interacting factor 1; deoxynucleotidyltransferase terminal interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagccactggcgacgccgagcagccgcggggacccagcggggccgagaggggcggcttggagctgggggatgcgggcgcagcggggcagctggttcttacgaacccttggaacataatgataaagcaccggcaggtgcagcggaggggccgccgctcacagatgacaacaagtttcacagatcctgccatctccatggatctcctccgagctgtcctgcagcccagcatcaacgaggagatccagactgtcttcaacaagtacatgaagttcttccagaaggcagcactgaacgtgcgagacaatgttggggaggaggtggacgcagagcagctgatccaggaagcctgtcggagctgcctggagcaggctaaactgctcttttcagatggagaaaaagtaatacccagattgacccatgagcttccaggaataaagcgtggccgtcaggcagaagaagaatgtgcccatcgaggaagcccccttcctaaaaagaggaaaggacggcctcctggacacatcctgtcaagcgaccgggcagccgccggcatggtatggaaaccaaaatcctgtgaaccaattcgccgggaaggccccaagtgggacccagctcgcctgaatgaatctaccacctttgtgttgggatctcgagccaacaaagccctggggatggggggcaccagaggaagaatctacatcaagcacccacacctctttaagtatgcagctgacccccaggataagcactggctggctgagcagcatcacatgcgggcaacagggggcaagatggcctacctcctcatcgaggaggacatccgggaccttgcggccagtgatgattacagaggatgcctggatctgaagctagaggaattgaaatcctttgtcctaccctcctggatggtggagaagatgagaaagtatatggagacactacggacagagaatgagcatcgtgctgttgaagcacctccacagacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipase A2, group IVC (cytosolic, calcium-independent)
- protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
- cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
- gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis)

Buy DNTTIP1-deoxynucleotidyltransferase, terminal, interacting protein 1 Gene now

Add to cart