Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene
PTXBC030717
New product
Data sheet of OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR2C3 |
| Origin species: | Human |
| Product name: | OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC030717 |
| Gene id: | 81472 |
| Gene description: | olfactory receptor, family 2, subfamily C, member 3 |
| Synonyms: | OR2C4; OR2C5P; OST742; olfactory receptor 2C3; olfactory receptor 2C4; olfactory receptor 2C5; olfactory receptor OR1-30; olfactory receptor, family 2, subfamily C, member 4; olfactory receptor, family 2, subfamily C, member 5 pseudogene; olfactory receptor family 2 subfamily C member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaatagccaatgtgagttctccagaagtctttgtcctcctgggcttctccgcacgaccctcactagaaactgtcctcttcatagttgtcttgagtttttacatggtatcgatcttgggcaatggcatcatcattctggtctcccatacagatgtgcacctccacacacctatgtacttctttcttgccaacctctccttcctggacatgagcttcaccacgagcattgtcccacagctcctggctaacctctggggaccacagaaaaccataagctatggagggtgtgtggtccagttctatatctcccattggctgggggcaaccgagtgtgtcctgctggccaccatgtcctatgaccgctacgctgccatctgcaggccactccattacactgtcattatgcatccacagctttgccttgggctagctttggcctcctggctggggggtctgaccaccagcatggtgggctccacgctcaccatgctcctaccgctgtgtgggaacaattgcatcgaccacttcttttgcgagatgcccctcattatgcaactggcttgtgtggataccagcctcaatgagatggagatgtacctggccagctttgtctttgttgtcctgcctctggggctcatcctggtctcttacggccacattgcccgggccgtgttgaagatcaggtcagcagaagggcggagaaaggcattcaacacctgttcttcccacgtggctgtggtgtctctgttttacgggagcatcatcttcatgtatctccagccagccaagagcacctcccatgagcagggcaagttcatagctctgttctacaccgtagtcactcctgcgctgaacccacttatttacaccctgaggaacacggaggtgaagagcgccctccggcacatggtattagagaactgctgtggctctgcaggcaagctggcgcaaatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - intraflagellar transport 81 homolog (Chlamydomonas) - actin related protein 2/3 complex, subunit 5, 16kDa - ribosomal RNA processing 15 homolog (S. cerevisiae) - membrane-spanning 4-domains, subfamily A, member 4 |