OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene View larger

OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030717
Product type: DNA & cDNA
Ncbi symbol: OR2C3
Origin species: Human
Product name: OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene
Size: 2ug
Accessions: BC030717
Gene id: 81472
Gene description: olfactory receptor, family 2, subfamily C, member 3
Synonyms: OR2C4; OR2C5P; OST742; olfactory receptor 2C3; olfactory receptor 2C4; olfactory receptor 2C5; olfactory receptor OR1-30; olfactory receptor, family 2, subfamily C, member 4; olfactory receptor, family 2, subfamily C, member 5 pseudogene; olfactory receptor family 2 subfamily C member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaatagccaatgtgagttctccagaagtctttgtcctcctgggcttctccgcacgaccctcactagaaactgtcctcttcatagttgtcttgagtttttacatggtatcgatcttgggcaatggcatcatcattctggtctcccatacagatgtgcacctccacacacctatgtacttctttcttgccaacctctccttcctggacatgagcttcaccacgagcattgtcccacagctcctggctaacctctggggaccacagaaaaccataagctatggagggtgtgtggtccagttctatatctcccattggctgggggcaaccgagtgtgtcctgctggccaccatgtcctatgaccgctacgctgccatctgcaggccactccattacactgtcattatgcatccacagctttgccttgggctagctttggcctcctggctggggggtctgaccaccagcatggtgggctccacgctcaccatgctcctaccgctgtgtgggaacaattgcatcgaccacttcttttgcgagatgcccctcattatgcaactggcttgtgtggataccagcctcaatgagatggagatgtacctggccagctttgtctttgttgtcctgcctctggggctcatcctggtctcttacggccacattgcccgggccgtgttgaagatcaggtcagcagaagggcggagaaaggcattcaacacctgttcttcccacgtggctgtggtgtctctgttttacgggagcatcatcttcatgtatctccagccagccaagagcacctcccatgagcagggcaagttcatagctctgttctacaccgtagtcactcctgcgctgaacccacttatttacaccctgaggaacacggaggtgaagagcgccctccggcacatggtattagagaactgctgtggctctgcaggcaagctggcgcaaatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intraflagellar transport 81 homolog (Chlamydomonas)
- actin related protein 2/3 complex, subunit 5, 16kDa
- ribosomal RNA processing 15 homolog (S. cerevisiae)
- membrane-spanning 4-domains, subfamily A, member 4

Buy OR2C3-olfactory receptor, family 2, subfamily C, member 3 Gene now

Add to cart