Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARPC5-actin related protein 2/3 complex, subunit 5, 16kDa Gene
PTXBC057237
New product
Data sheet of ARPC5-actin related protein 2/3 complex, subunit 5, 16kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARPC5-actin related protein 2/3 complex, subunit 5, 16kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057237 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARPC5 |
| Origin species: | Human |
| Product name: | ARPC5-actin related protein 2/3 complex, subunit 5, 16kDa Gene |
| Size: | 2ug |
| Accessions: | BC057237 |
| Gene id: | 10092 |
| Gene description: | actin related protein 2/3 complex, subunit 5, 16kDa |
| Synonyms: | ARC16; dJ127C7.3; p16-Arc; actin-related protein 2/3 complex subunit 5; Arp2/3 protein complex subunit p16; actin related protein 2/3 complex, subunit 5, 16kDa; arp2/3 complex 16 kDa subunit; actin related protein 2/3 complex subunit 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgaagaacacagtgtcgtcggcccgcttccggaaggtggacgtggatgaatatgacgagaacaagttcgtggacgaagaagatgggggcgacggccaggccgggcccgacgagggcgaggtggattcctgcctgcggcattccatcacaggaaacatgacagctgccctacaggcagctctgaagaacccccctatcaacaccaagagtcaggcagtgaaggaccgggcaggcagcattgtcttgaaggtgctcatctcttttaaagctaatgatatagaaaaggcagttcaatctctggacaagaatggtgtggatctcctaatgaagtatatttataaaggatttgagagcccgtctgacaatagcagtgctatgttactgcaatggcatgaaaaggcacttgctgctggaggagtagggtccattgttcgtgtcttgactgcaagaaaaactgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal RNA processing 15 homolog (S. cerevisiae) - membrane-spanning 4-domains, subfamily A, member 4 - anterior pharynx defective 1 homolog B (C. elegans) - advanced glycosylation end product-specific receptor |