Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A4A-membrane-spanning 4-domains, subfamily A, member 4 Gene
PTXBC020648
New product
Data sheet of MS4A4A-membrane-spanning 4-domains, subfamily A, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A4A-membrane-spanning 4-domains, subfamily A, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020648 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A4A |
| Origin species: | Human |
| Product name: | MS4A4A-membrane-spanning 4-domains, subfamily A, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC020648 |
| Gene id: | 51338 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 4 |
| Synonyms: | 4SPAN1; CD20-L1; CD20L1; HDCME31P; MS4A4; MS4A7; membrane-spanning 4-domains subfamily A member 4A; CD20 antigen-like 1; Fc epsilon receptor beta subunit homolog; four-span transmembrane protein 1; membrane-spanning 4-domains, subfamily A, member 4; membrane spanning 4-domains A4A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatcagacctacagcagacattgcaggcctgaagaaagcaccttttctgctgccatgacaaccatgcaaggaatggaacaggccatgccaggggctggccctggtgtgccccagctgggaaacatggctgtcatacattcacatctgtggaaaggattgcaagagaagttcttgaagggagaacccaaagtccttggggttgtgcagattctgactgccctgatgagccttagcatgggaataacaatgatgtgtatggcatctaatacttatggaagtaaccctatttccgtgtatatcgggtacacaatttgggggtcagtaatgtttattatttcaggatccttgtcaattgcagcaggaattagaactacaaaaggcctggtccgaggtagtctaggaatgaatatcaccagctctgtactggctgcatcagggatcttaatcaacacatttagcttggcgttttattcattccatcacccttactgtaactactatggcaactcaaataattgtcatgggactatgtccatcttaatgggtctggatggcatggtgctcctcttaagtgtgctggaattctgcattgctgtgtccctctctgcctttggatgtaaagtgctctgttgtacccctggtggggttgtgttaattctgccatcacattctcacatggcagaaacagcatctcccacaccacttaatgaggtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - anterior pharynx defective 1 homolog B (C. elegans) - advanced glycosylation end product-specific receptor - pleiotropic regulator 1 (PRL1 homolog, Arabidopsis) - ARD1 homolog A, N-acetyltransferase (S. cerevisiae) |