ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene View larger

ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene

PTXBC063377

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063377
Product type: DNA & cDNA
Ncbi symbol: ARD1A
Origin species: Human
Product name: ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene
Size: 2ug
Accessions: BC063377
Gene id: 8260
Gene description: ARD1 homolog A, N-acetyltransferase (S. cerevisiae)
Synonyms: ARD1A; ARD1; ARD1P; DXS707; MCOPS1; NATD; OGDNS; TE2; N-alpha-acetyltransferase 10; ARD1 homolog A, N-acetyltransferase; N-acetyltransferase ARD1, human homolog of; N-terminal acetyltransferase complex ARD1 subunit homolog A; natA catalytic subunit Naa10; N(alpha)-acetyltransferase 10, NatA catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacatccgcaatgcgaggccagaggacctaatgaacatgcagcactgcaacctcctctgcctgcccgagaactaccagatgaaatactacttctaccatggcctttcctggccccagctctcttacattgctgaggacgagaatgggaagattgtggggtatgtcctggccaaaatggaagaggacccagatgatgtgccccatggacatatcacctcattggctgtgaagcgttcccaccggcgcctcggtctggctcagaaactgatggaccaggcctctcgagccatgatagagaacttcaatgccaaatatgtctccctgcatgtcaggaagagatcagtgaagtggagcccaaatactatgcagatggggaggacgcctatgccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP-binding cassette, sub-family A (ABC1), member 3
- leukocyte-associated immunoglobulin-like receptor 2
- olfactory receptor, family 2, subfamily C, member 1
- ring finger and CHY zinc finger domain containing 1

Reviews

Buy ARD1A-ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene now

Add to cart