Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ABCA3-ATP-binding cassette, sub-family A (ABC1), member 3 Gene
PTXBC062779
New product
Data sheet of ABCA3-ATP-binding cassette, sub-family A (ABC1), member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ABCA3-ATP-binding cassette, sub-family A (ABC1), member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062779 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ABCA3 |
| Origin species: | Human |
| Product name: | ABCA3-ATP-binding cassette, sub-family A (ABC1), member 3 Gene |
| Size: | 2ug |
| Accessions: | BC062779 |
| Gene id: | 21 |
| Gene description: | ATP-binding cassette, sub-family A (ABC1), member 3 |
| Synonyms: | ABC-C; ABC3; EST111653; LBM180; SMDP3; ATP-binding cassette sub-family A member 3; ABC transporter 3; ABC-C transporter; ATP-binding cassette transporter 3; ATP-binding cassette, sub-family A (ABC1), member 3; ATP binding cassette subfamily A member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtgctcaggcagctggcgctcctcctctggaagaactacaccctgcagaagcggaaggtcctggtgacggtcctggaactcttcctgccattgctgttttctgggatcctcatctggctccgcttgaagattcagtcggaaaatgtgcccaacgccaccatctacccgggccagtccatccaggagctgcctctgttcttcaccttccctccgccaggagacacctgggagcttgcctacatcccttctcacagtgacgctgccaagaccgtcactgagacagtgcgcagggcacttgtgatcaacatgcgagtgcgcggctttccctccgagaaggactttgaggactacattaggtacgacaactgctcgtccagcgtgctggccgccgtggtcttcgagcaccccttcaaccacagcaaggagcccctgccgctggcggtgaaatatcacctacggttcagttacacacggagaaattacatgtggacccaaacaggctcctttttcctgaaagagacagaaggctggcacactacttcccttttcccgcttttcccaaacccaggaccaagggaacctacatcccctgatggcggagaacctggtgagaagctcggttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leukocyte-associated immunoglobulin-like receptor 2 - olfactory receptor, family 2, subfamily C, member 1 - ring finger and CHY zinc finger domain containing 1 - vacuolar protein sorting 29 homolog (S. cerevisiae) |