UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene View larger

UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene

PTXBC025369

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025369
Product type: DNA & cDNA
Ncbi symbol: UCHL5
Origin species: Human
Product name: UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene
Size: 2ug
Accessions: BC025369
Gene id: 51377
Gene description: ubiquitin carboxyl-terminal hydrolase L5
Synonyms: CGI-70; INO80R; UCH-L5; ubiquitin carboxyl-terminal hydrolase isozyme L5; INO80 complex subunit R; ubiquitin C-terminal hydrolase UCH37; ubiquitin carboxyl-terminal esterase L5; ubiquitin carboxyl-terminal hydrolase L5; ubiquitin thioesterase L5; ubiquitin C-terminal hydrolase L5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgggcaatgccggggagtggtgcctcatggaaagcgaccccggggtcttcaccgagctcattaaaggattcggttgccgaggagcccaagtagaagaaatatggagtttagagcctgagaattttgaaaaattaaagccagttcatgggttaatttttcttttcaagtggcagccaggagaagaaccagcaggctctgtggttcaggactcccgacttgacacgatattttttgctaagcaggtaattaataatgcttgtgctactcaagccatagtgagtgtgttactgaactgtacccaccaggatgtccatttaggcgagacattatcagagtttaaagaattttcacaaagttttgatgcagctatgaaaggcttggcactgagcaattcagatgtgattcgacaagtacacaacagtttcgccagacagcaaatgtttgaatttgatacgaagacatcagcaaaagaagaagatgcttttcactttgtcagttatgttcctgttaatgggagactgtatgaattagatggattaagagaaggaccgattgatttaggtgcatgcaatcaagatgattggatcagtgcagtaaggcctgtcatagaaaaaaggatacaaaagtacagtgaaggtgaaattcgatttaatttaatggccattgtgtctgacagaaaaatgatatatgagcagaagatagcagagttacaaagacaacttgcagaggaacccatggatacagatcaaggtaatagtatgttaagtgctattcagtcagaagttgccaaaaatcagatgcttattgaagaagaagtacagaaattaaaaagatacaagattgagaatatcagaaggaagcataattatctgcctttcattatggaattgttaaagactttagcagaacaccagcagttaataccactagtagaaaagtttgagaaacactttgagaagacactactaggcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor protein p53 inducible protein 13
- arginyl-tRNA synthetase 2, mitochondrial
- zinc finger, FYVE domain containing 16
- zinc finger, CCHC domain containing 10

Buy UCHL5-ubiquitin carboxyl-terminal hydrolase L5 Gene now

Add to cart