TP53I13-tumor protein p53 inducible protein 13 Gene View larger

TP53I13-tumor protein p53 inducible protein 13 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TP53I13-tumor protein p53 inducible protein 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TP53I13-tumor protein p53 inducible protein 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001593
Product type: DNA & cDNA
Ncbi symbol: TP53I13
Origin species: Human
Product name: TP53I13-tumor protein p53 inducible protein 13 Gene
Size: 2ug
Accessions: BC001593
Gene id: 90313
Gene description: tumor protein p53 inducible protein 13
Synonyms: tumor protein p53-inducible protein 13; damage-stimulated cytoplasmic protein 1; tumor protein p53 inducible protein 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggaccggcggaggaggcgggagcccattgtcccgagagcctgtggcctctgcctccgcaggtgtcaccaagagtgacctacacacgagtgagcccagggcaggctgaggatgtcaccttcctctaccacccctgtgcccatccctggctgaagctccagcttgccctcctggcctatgcttgtatggctaacccttccctcacccctgacttcagcctcacgcaggatcggcccctggtgctgactgcatgggggctggcgctggagatggcctgggtagagccagcctgggctgcccactggctgatgaggaggcggaggaggaagcagaggaagaagaaggcatggatctactgtgaaagcctttcagggcctgctccctccgagccaactcccggtagagggaggctgtgccgaagagggtgtgtgcaggccctggctctggcctttgctctgcggagctggcggccccctggcacagaggtgacatctcaagggcccaggcagccctcttctagtggtgccaagaggcggaggctgcgggctgcccttggtccccagcccactcgctcagccctgaggtttccctctgcttccccagggagcttgaaggccaagcagtccatggcgggaatccctggtagggagagtaatgccccatctgtgcccactgtctccctgctgccgggggcgcctggaggcaatgccagctccaggacagaggctcaggtgcccaacgggcaaggcagcccagggggctgtgtctgttcaagtcaggcttccccggcccctcgcgcagcagcgcctccacgggcagcccggggccccaccccacgcactgaagaggccgcctgggctgccatggccctgaccttcctgctggtgctgctcaccctggccacgctctgcacacggctgcacagaaacttccgacgcggggagagcatctactgggggcccacagcggacagccaggacacagtggctgctgtgctgaagcggaggctgctgcagccctcgcgccgggtcaagcgctcgcgccggagacccctcctcccgcccacgccggacagcggcccggaaggcgagagctcggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arginyl-tRNA synthetase 2, mitochondrial
- zinc finger, FYVE domain containing 16
- zinc finger, CCHC domain containing 10
- cell death-inducing DFFA-like effector b

Buy TP53I13-tumor protein p53 inducible protein 13 Gene now

Add to cart