RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene View larger

RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene

PTXBC022341

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022341
Product type: DNA & cDNA
Ncbi symbol: RARS2
Origin species: Human
Product name: RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene
Size: 2ug
Accessions: BC022341
Gene id: 57038
Gene description: arginyl-tRNA synthetase 2, mitochondrial
Synonyms: ArgRS; DALRD2; PCH6; PRO1992; RARSL; arginyl-tRNA synthetase 2, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtgcggctttcgccgcgctattgcttgccagctttccagagtgttgaatcttccaccagaaaacttgatcacatcaatatctgcagttccaatttcccaaaaagaagaagtagctgattttcagctttctgtggattctttattggaaaaagacaatgaccattcaagaccagatattcaagttcaagccaagagactagcagagaagctaagatgtgatacagtggtgagtgaaatcagtactggtcaaaggactgtaaatttcaaaataaacagagagctcttaacaaagacagtgctacaacaagtaattgaagatggctcaaaatatggattaaaaagtgaacttttctctggacttccccagaagaagattgtggttgaattcagttcacctaatgttgccaaaaaatttcatgttggacatttgcgttctaccatcataggaaattttatagcaaatctcaaagaagctttaggacatcaagtaataagaataaattaccttggcgattggggcatgcagtttggtcttctgggaactggcttccagctgtttggctatgaggaaaaactgcagtccaatcctctacagcatctctttgaagtttatgtacaagttaataaagaagcagcagatgataaaagtgtagcaaaagcagcacaggagttcttccaacgattggaactgggcgatgtgcaagcactttcactgtggcaaaaatttcgggacttgagcattgaagagtacattcgggtttacaagcgtctgggagtatattttgatgaatattcaggagaatcattttatcgtgaaaaatctcaagaggtcttaaagttgctggagagtaaaggactcctactgaaaacaataaaaggaacggctgtagtagatctctctgggaatggcgacccctcctcaatttgtactgtaatgcgaagtgatgggacttctctctatgcaaccagagatcttgcagctgctatagatcgaatggacaagtataattttgatacaatgatatatgtgataaaggacaaaaaaagcattttcagcaagtattccaaatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, FYVE domain containing 16
- zinc finger, CCHC domain containing 10
- cell death-inducing DFFA-like effector b
- isopentenyl-diphosphate delta isomerase 2

Buy RARS2-arginyl-tRNA synthetase 2, mitochondrial Gene now

Add to cart