GTPBP8-GTP-binding protein 8 (putative) Gene View larger

GTPBP8-GTP-binding protein 8 (putative) Gene

PTXBC037163

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTPBP8-GTP-binding protein 8 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GTPBP8-GTP-binding protein 8 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037163
Product type: DNA & cDNA
Ncbi symbol: GTPBP8
Origin species: Human
Product name: GTPBP8-GTP-binding protein 8 (putative) Gene
Size: 2ug
Accessions: BC037163
Gene id: 29083
Gene description: GTP-binding protein 8 (putative)
Synonyms: HSPC135; GTP-binding protein 8; GTP binding protein 8 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgccccctacgggaggcaagaccttcacctgcgtatctttgacccaagcccggaggacatagccagggcggacaacatcttcacggccactgaacggaaccgcatcgactacgtcagctccgccgtccgtatcgaccacgccccggaccttccgcggccagaggtgtgttttataggcagaagcaatgttggaaaatcatctctaatcaaggctttattttcactggcccctgaggttgaagtcagagtctccaaaaaaccaggacacacaaagaaaatgaattttttcaaagttggaaaacattttacagtggtggacatgccaggttatggctttagagcacctgaagattttgttgacatggtagagacctatctaaaagaacgaaggaacttgaagagaacatttttattagtggatagcgttgttggaattcaaaaaacagacaatattgccatagaaatgtgtgaagaatttgcattaccttatgtgattgtattaacaaaaattgacaaatcttccaagggacatcttttaaaacaagtgcttcagatccagaaatttgttaacatgaaaactcaaggatgttttcctcagttgtttcctgtaagtgctgtgaccttttctggaatccacctgttgagatgctttatagccagtgtaacaggaagtcttgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GTP binding protein 5 (putative)
- polymerase (DNA directed), epsilon
- coiled-coil domain containing 23
- coiled-coil domain containing 26

Buy GTPBP8-GTP-binding protein 8 (putative) Gene now

Add to cart