CCDC26-coiled-coil domain containing 26 Gene View larger

CCDC26-coiled-coil domain containing 26 Gene

PTXBC026098

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC26-coiled-coil domain containing 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC26-coiled-coil domain containing 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026098
Product type: DNA & cDNA
Ncbi symbol: CCDC26
Origin species: Human
Product name: CCDC26-coiled-coil domain containing 26 Gene
Size: 2ug
Accessions: BC026098
Gene id: 137196
Gene description: coiled-coil domain containing 26
Synonyms: coiled-coil domain-containing protein 126; coiled-coil domain containing 126
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaagattgtgcctgcagcctggcctgttgcccacagcggtctacctgccacactgggaaagatcgagcagagacagagaagaaaaggaggctccatttttcaggctgctctcccgcaggctcatgttttgtgttcatgccaggcagagaacacaaaatgttccaataaataagtatcaaaggttagtggtgaaaatgaaggaggaagaggcattgcgtgaaaaactaaacatgcaaaatattacacacaaagagaaccaaaatgcaggttcactggaaatgatagacaatatgttaaaacaagaggagagaagagagctgaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 12
- ribonuclease, RNase A family, k6
- RAB8B, member RAS oncogene family
- coiled-coil domain containing 59

Buy CCDC26-coiled-coil domain containing 26 Gene now

Add to cart