GTPBP5-GTP binding protein 5 (putative) Gene View larger

GTPBP5-GTP binding protein 5 (putative) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTPBP5-GTP binding protein 5 (putative) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GTPBP5-GTP binding protein 5 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036716
Product type: DNA & cDNA
Ncbi symbol: GTPBP5
Origin species: Human
Product name: GTPBP5-GTP binding protein 5 (putative) Gene
Size: 2ug
Accessions: BC036716
Gene id: 26164
Gene description: GTP binding protein 5 (putative)
Synonyms: GTPBP5; dJ1005F21.2; mitochondrial ribosome-associated GTPase 2; GTP binding protein 5 (putative); GTP-binding protein 5; protein obg homolog 1; mitochondrial ribosome associated GTPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacctgcaaggtgtttttcagcaagattgaggaccgtgtttcagggcgtggggcattgggctttgtccacatgggctggcctgaagcccagccggctactgccacagcgggcttctcccaggctgctctcggtcggccgtgcggacctcgccaagcatcaggaactcccggggaagaagctgctctctgagaaaaagctgaaaaggtactttgtggactatcggagagtgcttgtctgtggaggaaacggaggcgctggggcaagctgcttccacagtgagccccgcaaggagtttggaggccctgatggaggggacggaggcaacggtggacacgtcattctgagagttgaccagcaagtcaagtccctgtcgtcggtcctgtcgcggtaccagggtttcagtggagaagatggagggagtaaaaactgcttcgggcgcagtggcgccgtcctctacatccgggtccccgtgggcacgctggtgaaggagggaggcagagttgtggccgacctgtcttgcgtgggagatgagtacattgccgcgctgggcggggcaggagggaaaggcaaccgcttcttcctggccaacaacaaccgtgcccctgtgacctgtacccctggacagccaggacagcagcgagttctccacctggagctcaagacggtggcccacgccggaatggtgggattccccaacgccgggaagtcctcactgctccgggccatttcaaacgccagacccgccgtggcttcctacccgttcaccaccctgaagccccacgtcgggatcgtccactacgaaggccacctacaaatagcagtggccgacatccccggcatcatacgaggcgcccaccagaacaggggtctggggtccgccttcctcaggcacatcgagcgctgccgctttctcttgttcgtggtggatctttctcagcctgagccgtggactcaagttgacgatttaaaatatgaactggagatgtatgaaaagggcctgtctgcgaggccccacgcaatcgtcgcaaacaagattgacctccctgaagcccaagccaatctgtcccagctccgggatcacttgggacaggaggtcatcgtgctgtcggcgttgaccggcgagaacctggagcagctgctgttgcacctgaaggtgctgtatgacgcctacgcggaggccgagctgggccagggccgccagccgctcaggtggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (DNA directed), epsilon
- coiled-coil domain containing 23
- coiled-coil domain containing 26
- coiled-coil domain containing 12

Buy GTPBP5-GTP binding protein 5 (putative) Gene now

Add to cart