Login to display prices
Login to display prices
ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene View larger

ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene

PTXBC025963

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene

Proteogenix catalog: PTXBC025963
Ncbi symbol: ACADS
Product name: ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene
Size: 2ug
Accessions: BC025963
Gene id: 35
Gene description: acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain
Synonyms: ACAD3; SCAD; short-chain specific acyl-CoA dehydrogenase, mitochondrial; acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain; butyryl-CoA dehydrogenase; mitochondrial short-chain specific acyl-CoA dehydrogenase; unsaturated acyl-CoA reductase; acyl-CoA dehydrogenase, C-2 to C-3 short chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgccgcgctgctcgcccgggcctcgggccctgcccgcagagctctctgtcctagggcctggcggcagttacacaccatctaccagtctgtggaactgcccgagacacaccagatgttgctccagacatgccgggactttgccgagaaggagttgtttcccattgcagcccaggtggataaggaacatctcttcccagcggctcaggtgaagaagatgggcgggcttgggcttctggccatggacgtgcccgaggagcttggcggtgctggcctcgattacctggcctacgccatcgccatggaggagatcagccgcggctgcgcctccaccggagtcatcatgagtgtcaacaactctctctacctggggcccatcttgaagtttggctccaaggagcagaagcaggcgtgggtcacgcctttcaccagtggtgacaaaattggctgctttgccctcagcgaaccagggaacggcagtgatgcaggagctgcgtccaccaccgcccgggccgagggcgactcatgggttctgaatggaaccaaagcctggatcaccaatgcctgggaggcttcggctgccgtggtctttgccagcacggacagagccctgcaaaacaagagcatcagtgccttcctggtccccatgccaacgcctgggctcacgttggggaagaaagaagacaagctgggcatccggggctcatccacggccaacctcatctttgaggactgtcgcatccccaaggacagcatcctgggggagccagggatgggcttcaagatagccatgcaaaccctggacatgggccgcatcggcatcgcctcccaggccctgggcattgcccagaccgccctcgattgtgctgtgaactacgctgagaatcgcatggccttcggggcgcccctcaccaagctccaggtcatccagttcaagttggcagacatggccctggccctggagagtgcccggctgctgacctggcgtgctgccatgctgaaggataacaagaagcctttcatcaaggaggcagccatggccaagctggccgcctcggaggccgcgaccgccatcagccaccaggccatccagatcctgggcggcatgggctacgtgacagagatgccggcagagcggcactaccgcgacgcccgcatcactgagatctacgagggcaccagcgaaatccagcggctggtgatcgccgggcatctgctcaggagctaccggagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: