Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene
PTXBC025963
New product
Data sheet of ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025963 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACADS |
| Origin species: | Human |
| Product name: | ACADS-acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain Gene |
| Size: | 2ug |
| Accessions: | BC025963 |
| Gene id: | 35 |
| Gene description: | acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain |
| Synonyms: | ACAD3; SCAD; short-chain specific acyl-CoA dehydrogenase, mitochondrial; acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain; butyryl-CoA dehydrogenase; mitochondrial short-chain specific acyl-CoA dehydrogenase; unsaturated acyl-CoA reductase; acyl-CoA dehydrogenase, C-2 to C-3 short chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgccgcgctgctcgcccgggcctcgggccctgcccgcagagctctctgtcctagggcctggcggcagttacacaccatctaccagtctgtggaactgcccgagacacaccagatgttgctccagacatgccgggactttgccgagaaggagttgtttcccattgcagcccaggtggataaggaacatctcttcccagcggctcaggtgaagaagatgggcgggcttgggcttctggccatggacgtgcccgaggagcttggcggtgctggcctcgattacctggcctacgccatcgccatggaggagatcagccgcggctgcgcctccaccggagtcatcatgagtgtcaacaactctctctacctggggcccatcttgaagtttggctccaaggagcagaagcaggcgtgggtcacgcctttcaccagtggtgacaaaattggctgctttgccctcagcgaaccagggaacggcagtgatgcaggagctgcgtccaccaccgcccgggccgagggcgactcatgggttctgaatggaaccaaagcctggatcaccaatgcctgggaggcttcggctgccgtggtctttgccagcacggacagagccctgcaaaacaagagcatcagtgccttcctggtccccatgccaacgcctgggctcacgttggggaagaaagaagacaagctgggcatccggggctcatccacggccaacctcatctttgaggactgtcgcatccccaaggacagcatcctgggggagccagggatgggcttcaagatagccatgcaaaccctggacatgggccgcatcggcatcgcctcccaggccctgggcattgcccagaccgccctcgattgtgctgtgaactacgctgagaatcgcatggccttcggggcgcccctcaccaagctccaggtcatccagttcaagttggcagacatggccctggccctggagagtgcccggctgctgacctggcgtgctgccatgctgaaggataacaagaagcctttcatcaaggaggcagccatggccaagctggccgcctcggaggccgcgaccgccatcagccaccaggccatccagatcctgggcggcatgggctacgtgacagagatgccggcagagcggcactaccgcgacgcccgcatcactgagatctacgagggcaccagcgaaatccagcggctggtgatcgccgggcatctgctcaggagctaccggagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel tetramerisation domain containing 9 - olfactory receptor, family 51, subfamily E, member 2 - potassium channel tetramerisation domain containing 6 - proteasome (prosome, macropain) subunit, beta type, 1 |