TMEM111-transmembrane protein 111 Gene View larger

TMEM111-transmembrane protein 111 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM111-transmembrane protein 111 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM111-transmembrane protein 111 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022807
Product type: DNA & cDNA
Ncbi symbol: TMEM111
Origin species: Human
Product name: TMEM111-transmembrane protein 111 Gene
Size: 2ug
Accessions: BC022807
Gene id: 55831
Gene description: transmembrane protein 111
Synonyms: TMEM111; POB; ER membrane protein complex subunit 3; 30 kDa protein; partial optokinetic response b; transmembrane protein 111
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagggccagaactgttgctcgactccaacatccgcctctgggtggtcttacccatcgttatcatcactttcttcgtaggcatgatccgccactacgtgtccatcctgctgcagagcgacaagaagctcacccaggaacaagtatctgacagtcaagtcctaattcgaagcagagtcctcagggaaaatggaaaatacattcccaaacagtctttcttgacacgaaaatattatttcaacaacccagaggatggatttttcaaaaaaactaaacggaaggtagtgccaccttctcctatgactgatcctactatgttgacagacatgatgaaagggaatgtaacaaatgtcctccctatgattcttattggtggatggatcaacatgacattctcaggctttgtcacaaccaaggtcccatttccactgaccctccgttttaagcctatgttacagcaaggaatcgagctactcacattagatgcatcctgggtgagttctgcatcctggtacttcctcaatgtatttgggcttcggagcatttactctctgattctgggccaagataatgccgctgaccaatcacgaatgatgcaggagcagatgacgggagcagccatggccatgcccgcagacacaaacaaagctttcaagacagagtgggaagctttggagctgacggatcaccagtgggcactagatgatgtcgaagaagagctcatggccaaagacctccacttcgaaggcatgttcaaaaaggaattacagacctctattttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MTERF domain containing 3
- jumonji domain containing 7
- mediator of cell motility 1
- M-phase phosphoprotein 6

Buy TMEM111-transmembrane protein 111 Gene now

Add to cart