JMJD7-jumonji domain containing 7 Gene View larger

JMJD7-jumonji domain containing 7 Gene

PTXBC025290

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of JMJD7-jumonji domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about JMJD7-jumonji domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025290
Product type: DNA & cDNA
Ncbi symbol: JMJD7
Origin species: Human
Product name: JMJD7-jumonji domain containing 7 Gene
Size: 2ug
Accessions: BC025290
Gene id: 100137047
Gene description: jumonji domain containing 7
Synonyms: JMJD7-PLA2G4B readthrough; JMJD7-PLA2G4B protein; HsT16992; cPLA2-beta; jumonji domain containing 7-phospholipase A2, group IVB (cytosolic) read-through
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaggcggctttggaagccgtgcggagcgagttacgagaattcccggccgctgcaagggagctctgcgtgcctcttgctgtgccctacctggacaaacccccaactccgctccacttctaccgggactgggtctgccccaacaggccgtgcattatccgcaacgctctgcagcactggccggccctccagaagtggtccctcccctatttcagagccacagtgggctccacagaggtgagtgtggccgtgaccccagatggttacgcggatgccgtgagaggggatcgcttcatgatgccagctgagcgccgcctgcccctgagcttcgtgctggatgtgctggagggccgggcccagcaccctggagtcctctatgtgcagaagcagtgctccaacctgcccagcgagctgccccagctgctgcctgatctggaatcccatgtgccctgggcctccgaagccctgggaaagatgcccgatgctgtgaacttctggctgggggaggcggctgcagtgacttctttgcacaaggaccactatgagaacctctactgcgtggtctcaggagagaagcatttcctgttccatccgcccagcgaccggcccttcatcccctatgagctgtacacgccggcaacctaccagctaactgaagagggcacctttaaggtggtggatgaagaggccatggagaaggtgccctggatcccactggaccccttggcgccagacctagcacggtaccctagttacagtcaggcccaggcccttcgctgcacggtgcgggccggtgagatgctctatctgccggctctgtggttccaccacgtccagcagtcccagggctgcatcgcagtgaatttctggtatgacatggaatacgacctcaagtatagttacttccagctgctcgactccctcaccaaggcttcaggccttgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mediator of cell motility 1
- M-phase phosphoprotein 6
- Vpr (HIV-1) binding protein
- GLI pathogenesis-related 2

Buy JMJD7-jumonji domain containing 7 Gene now

Add to cart