MEMO1-mediator of cell motility 1 Gene View larger

MEMO1-mediator of cell motility 1 Gene

PTXBC018733

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEMO1-mediator of cell motility 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MEMO1-mediator of cell motility 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018733
Product type: DNA & cDNA
Ncbi symbol: MEMO1
Origin species: Human
Product name: MEMO1-mediator of cell motility 1 Gene
Size: 2ug
Accessions: BC018733
Gene id: 51072
Gene description: mediator of cell motility 1
Synonyms: protein MEMO1; C2orf4; CGI-27; MEMO; NS5ATP7; C21orf19-like protein; HCV NS5A-transactivated protein 7; hepatitis C virus NS5A-transactivated protein 7; mediator of ErbB2-driven cell motility 1; mediator of cell motility 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaaccgagtggtctgccgagaagccagtcacgccgggagctggtacacagcctcaggaccgcagctgaatgcacagctagaaggttggctttcacaagtacagtctacaaaaagacctgctagagccattattgccccccatgcaggatatacgtactgtgggtcttgtgctgcccatgcttataaacaagtggatccgtctattacccggagaattttcatccttgggccttctcatcatgtgcccctctctcgatgtgcactttccagtgtggatatatataggacacctctgtatgaccttcgtattgaccaaaagatttacggagaactgtggaagacaggaatgtttgaacgcatgtctctgcagacagatgaagatgaacacagtattgaaatgcatttgccttatacagctaaagccatggaaagccataaggatgagtttaccattattcctgtactggttggagctctgagtgagtcaaaagaacaggaattcggaaaactcttcagtaaatatctagcggatcctagtaatctctttgtggtttcttctgatttctgccattggggtcaaaggttccgttacagttactatgatgaatcccagggggagatttatagatccattgaacatctagataaaatgggtatgagtattatagaacaattagaccctgtatcttttagcaattacttgaagaaataccataatactatatgtggaagacatcccattggggtgttattaaatgctatcacagagctccagaagaatggaatgaatatgagtttttcgtttttgaattatgcccagtcgagccagtgtagaaactggcaagacagttcagtgagttatgcagctggagcactcacggtccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - M-phase phosphoprotein 6
- Vpr (HIV-1) binding protein
- GLI pathogenesis-related 2
- transmembrane protein 182

Buy MEMO1-mediator of cell motility 1 Gene now

Add to cart