Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C9orf23-chromosome 9 open reading frame 23 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C9orf23-chromosome 9 open reading frame 23 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032136 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C9orf23 |
| Origin species: | Human |
| Product name: | C9orf23-chromosome 9 open reading frame 23 Gene |
| Size: | 2ug |
| Accessions: | BC032136 |
| Gene id: | 138716 |
| Gene description: | chromosome 9 open reading frame 23 |
| Synonyms: | alba-like protein C9orf23; C9orf23; bA296L22.5; ribonuclease P protein subunit p25-like protein; RNase P protein subunit-like p25; ribonuclease P/MRP 25kDa subunit-like; rpp25-like protein; ribonuclease P/MRP subunit p25 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcactaccggaaagctggctctgtagagctcccagcgccttccccaatgccccagctacctcctgatacccttgagatgcgggtccgagatggcagcaaaattcgcaacctgctggggttggctctgggtcggttggagggcggcagtgctcggcatgtagtgttctcaggttctggcagggctgcaggaaaggctgtcagctgcgctgagattgtcaagcggcgggtcccaggcctgcaccagctcaccaagctacgtttccttcagactgaggacagctgggtcccagcctcacctgacacagggctagaccccctcacagtgcgccgccatgtgcctgcagtgtgggtgctgctcagccgggaccccctggaccccaatgagtgtggttaccaacccccaggagcaccccctggcctgggttccatgcccagctccagctgtggccctcgttcccgaagaagggctcgagacacccgatcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S15 - chromosome 4 open reading frame 31 - mitochondrial ribosomal protein L19 - chromosome 21 open reading frame 2 |