Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C1QA-complement component 1, q subcomponent, A chain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1QA-complement component 1, q subcomponent, A chain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030153 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1QA |
| Origin species: | Human |
| Product name: | C1QA-complement component 1, q subcomponent, A chain Gene |
| Size: | 2ug |
| Accessions: | BC030153 |
| Gene id: | 712 |
| Gene description: | complement component 1, q subcomponent, A chain |
| Synonyms: | complement C1q subcomponent subunit A; complement C1q chain A; complement component 1, q subcomponent, A chain; complement component 1, q subcomponent, alpha polypeptide; complement component C1q, A chain; complement C1q A chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggtccccggggatggctggtgctctgtgtgctggccatatcgctggcctctatggtgaccgaggacttgtgccgagcaccagacgggaagaaaggggaggcaggaagacctggcagacgggggcggccaggcctcaagggggagcaaggggagccgggggcccctggcatccggacaggcatccaaggccttaaaggagaccagggggaacctgggccctctggaaaccccggcaaggtgggctacccagggcccagcggccccctcggggcccgtggcatcccgggaattaaaggcaccaagggcagcccaggaaacatcaaggaccagccgaggccagccttctccgccattcggcggaaccccccaatggggggcaacgtggtcatcttcgacacggtcatcaccaaccaggaagaaccgtaccagaaccactccggccgattcgtctgcactgtacccggctactactacttcaccttccaggtgctgtcccagtgggaaatctgcctgtccatcgtctcctcctcaaggggccaggtccgacgctccctgggcttctgtgacaccaccaacaaggggctcttccaggtggtgtcagggggcatggtgcttcagctgcagcagggtgaccaggtctgggttgaaaaagaccccaaaaagggtcacatttaccagggctctgaggccgacagcgtcttcagcggcttcctcatcttcccatctgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - developmentally regulated GTP binding protein 1 - DnaJ (Hsp40) homolog, subfamily C, member 18 - B-cell CLL/lymphoma 11A (zinc finger protein) - copper metabolism (Murr1) domain containing 1 |