Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BUD31-BUD31 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BUD31-BUD31 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022821 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BUD31 |
| Origin species: | Human |
| Product name: | BUD31-BUD31 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC022821 |
| Gene id: | 8896 |
| Gene description: | BUD31 homolog (S. cerevisiae) |
| Synonyms: | BUD31 homolog; protein BUD31 homolog; Cwc14; EDG-2; EDG2; YCR063W; fSAP17; G10 maternal transcript homolog; functional spliceosome-associated protein 17; maternal G10 transcript; protein EDG-2; protein G10 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctaaagtcaaaagaagccggaaagcacccccagatggctgggagttgattgagccaacactggatgaattagatcaaaagatgagagaagctgaaacagaaccgcatgagggaaagaggaaagtggaatctctgtggcccatcttcaggatccaccaccagaaaacccgctacatcttcgacctcttttacaagcggaaagccatcagcagagaactctatgaatattgtattaaagaaggctatgcagacaaaaacctgattgcaaaatggaaaaagcaaggatatgagaacttgtgctgcctgcggtgcattcagacacgggacaccaacttcgggacgaactgcatctgccgcgtgcccaaaagcaagctggaagtgggccgcatcatcgagtgcacacactgtggctgtcgtggctgctctggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - twist homolog 2 (Drosophila) - asialoglycoprotein receptor 1 - transmembrane protein 167A - hepcidin antimicrobial peptide |