TMEM167A-transmembrane protein 167A Gene View larger

TMEM167A-transmembrane protein 167A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM167A-transmembrane protein 167A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM167A-transmembrane protein 167A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026285
Product type: DNA & cDNA
Ncbi symbol: TMEM167A
Origin species: Human
Product name: TMEM167A-transmembrane protein 167A Gene
Size: 2ug
Accessions: BC026285
Gene id: 153339
Gene description: transmembrane protein 167A
Synonyms: TMEM167; protein kish-A; transmembrane protein 167; transmembrane protein 167A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgccattttcaattttcagagtctattgactgtaatcttgctgcttatatgtacctgtgcttatattcgatccttggcacccagcctcctggacagaaataaaactggattgttgggtatattttggaagtgtgccagaattggtgaacggaagagtccttatgttgcagtatgctgtatagtaatggccttcagcatcctcttcatacagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hepcidin antimicrobial peptide
- Wolfram syndrome 1 (wolframin)
- interferon-induced protein 44
- Fas (TNFRSF6) binding factor 1

Buy TMEM167A-transmembrane protein 167A Gene now

Add to cart