HAMP-hepcidin antimicrobial peptide Gene View larger

HAMP-hepcidin antimicrobial peptide Gene

PTXBC020612

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAMP-hepcidin antimicrobial peptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HAMP-hepcidin antimicrobial peptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020612
Product type: DNA & cDNA
Ncbi symbol: HAMP
Origin species: Human
Product name: HAMP-hepcidin antimicrobial peptide Gene
Size: 2ug
Accessions: BC020612
Gene id: 57817
Gene description: hepcidin antimicrobial peptide
Synonyms: HEPC; HFE2B; LEAP1; PLTR; hepcidin; liver-expressed antimicrobial peptide 1; hepcidin antimicrobial peptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcactgagctcccagatctgggccgcttgcctcctgctcctcctcctcctcgccagcctgaccagtggctctgttttcccacaacagacgggacaacttgcagagctgcaaccccaggacagagctggagccagggccagctggatgcccatgttccagaggcgaaggaggcgagacacccacttccccatctgcattttctgctgcggctgctgtcatcgatcaaagtgtgggatgtgctgcaagacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Wolfram syndrome 1 (wolframin)
- interferon-induced protein 44
- Fas (TNFRSF6) binding factor 1
- transmembrane protein 185A

Buy HAMP-hepcidin antimicrobial peptide Gene now

Add to cart