Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM125B-family with sequence similarity 125, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM125B-family with sequence similarity 125, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028675 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM125B |
| Origin species: | Human |
| Product name: | FAM125B-family with sequence similarity 125, member B Gene |
| Size: | 2ug |
| Accessions: | BC028675 |
| Gene id: | 89853 |
| Gene description: | family with sequence similarity 125, member B |
| Synonyms: | Fam125b; 2610200O14Rik; 2610528K11Rik; AI414895; multivesicular body subunit 12B; ESCRT-I complex subunit MVB12B; family with sequence similarity 125, member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaagctgcttctgcgtgagacggagccgggacccgccgccgccgcagccaccgccgccgccgccccagcggggaacagaccagtccaccatgcctgaagtcaaagacctctcagaagccttgccagaaacatcaatggatcccatcacgggagtcggggtggtggcttctcggaaccgagccccgacaggctatgacgtagttgcacagacagcagatggtgtggatgctgacctctggaaagacggcttatttaaatccaaggttaccagatacctgtgtttcacaagatcattttccaaagaaaatagtcatctggggaacgtgttagtagatatgaagctcattgacatcaaggacacactgcctgtgggcttcatcccaattcaggagacggtggacacacaggaagtggcttttaggaagaagaggctgtgcattaaatttattccacgggattcaacggaagctgcgatttgtgacattcggatcatgggccggaccaagcaggccccgcctcagtacacgtttattggggaactgaacagcatggggatctggtatcgaatgggcagagtaccaagaaatcatgactcatctcaacccacaacgccttcccagtcatcagctgcctccaccccagcccccaaccttcccaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small nuclear ribonucleoprotein polypeptide A' - ATG3 autophagy related 3 homolog (S. cerevisiae) - purinergic receptor P2Y, G-protein coupled, 12 - family with sequence similarity 110, member B |