P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene View larger

P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene

PTXBC017898

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017898
Product type: DNA & cDNA
Ncbi symbol: P2RY12
Origin species: Human
Product name: P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene
Size: 2ug
Accessions: BC017898
Gene id: 64805
Gene description: purinergic receptor P2Y, G-protein coupled, 12
Synonyms: purinergic receptor P2RY12; ADPG-R; BDPLT8; HORK3; P2T(AC); P2Y(12)R; P2Y(AC); P2Y(ADP); P2Y(cyc); SP1999; P2Y purinoceptor 12; ADP-glucose receptor; G-protein coupled receptor SP1999; Gi-coupled ADP receptor HORK3; P2Y12 platelet ADP receptor; purinergic receptor P2Y, G-protein coupled, 12; purinergic receptor P2Y12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagccgtcgacaatctcacctctgcgcctgggaacaccagtctgtgcaccagagactacaaaatcacccaggtcctcttcccactgctctacactgtcctgttttttgttggacttatcacaaatggcctggcgatgaggattttctttcaaatccggagtaaatcaaactttattatttttcttaagaacacagtcatttctgatcttctcatgattctgacttttccattcaaaattcttagtgatgccaaactgggaacaggaccactgagaacttttgtgtgtcaagttacctccgtcatattttatttcacaatgtatatcagtatttcattcctgggactgataactatcgatcgctaccagaagaccaccaggccatttaaaacatccaaccccaaaaatctcttgggggctaagattctctctgttgtcatctgggcattcatgttcttactctctttgcctaacatgattctgaccaacaggcagccgagagacaagaatgtgaagaaatgctctttccttaaatcagagttcggtctagtctggcatgaaatagtaaattacatctgtcaagtcattttctggattaatttcttaattgttattgtatgttatacactcattacaaaagaactgtaccggtcatacgtaagaacgaggggtgtaggtaaagtccccaggaaaaaggtgaacgtcaaagttttcattatcattgctgtattctttatttgttttgttcctttccattttgcccgaattccttacaccctgagccaaacccgggatgtctttgactgcactgctgaaaatactctgttctatgtgaaagagagcactctgtggttaacttccttaaatgcatgcctggatccgttcatctattttttcctttgcaagtccttcagaaattccttgataagtatgctgaagtgccccaattctgcaacatctctgtcccaggacaataggaaaaaagaacaggatggtggtgacccaaatgaagagactccaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 110, member B
- adaptor-related protein complex 4, mu 1 subunit
- patatin-like phospholipase domain containing 4
- adaptor-related protein complex 3, mu 2 subunit

Buy P2RY12-purinergic receptor P2Y, G-protein coupled, 12 Gene now

Add to cart