Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AP3M2-adaptor-related protein complex 3, mu 2 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP3M2-adaptor-related protein complex 3, mu 2 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP3M2 |
| Origin species: | Human |
| Product name: | AP3M2-adaptor-related protein complex 3, mu 2 subunit Gene |
| Size: | 2ug |
| Accessions: | BC056257 |
| Gene id: | 10947 |
| Gene description: | adaptor-related protein complex 3, mu 2 subunit |
| Synonyms: | AP47B; CLA20; P47B; AP-3 complex subunit mu-2; HA1 47 kDa subunit homolog 2; HA1 47kDA subunit homolog 2; adapter-related protein complex 3 mu-2 subunit; adapter-related protein complex 3 subunit mu-2; adaptor-related protein complex 3 subunit mu-2; clathrin assembly protein assembly protein complex 1 medium chain homolog 2; clathrin assembly protein assembly protein complex 3 mu-2 medium chain; clathrin coat assembly protein AP47 homolog 2; clathrin coat-associated protein AP47 homolog 2; clathrin-associated protein AP47 homolog 2; golgi adaptor AP-1 47 kDA protein homolog 2; mu3B-adaptin; adaptor related protein complex 3 mu 2 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccatagtcttttcttgatcaactcctctggagacattttcctggagaaacattggaaaagtgtggtcagccgttctgtttgtgattacttttttgaggcgcaagagagagctactgaggcagaaaatgtgcctccggttatccctacccctcaccactatctcttaagtgtttaccgccacaagatcttttttgtggccgtgatccagacggaggtcccccctctgtttgtcattgagtttcttcaccgagtggtggacacatttcaggattattttggagtctgttcagagccagtgatcaaagacaatgtagttgtggtttatgaggtattggaagagatgcttgacaatggttttccattggctaccgagtcgaacattcttaaagaactcataaagcctcctaccatccttcgaacggttgtcaacaccatcacaggaagcacgaatgtgggtgaccagcttcccactgggcagctgtcagtggtgccttggcgacggactggggtgaaatataccaacaatgaggcctattttgatgtgattgaagagattgatgcaattattgataaatcaggctccacaattactgctgagatccagggggtgattgatgcctgtgtcaagctgactggcatgccagaccttacactttccttcatgaaccctaggttgttggatgatgtcagcttccatccttgtgttcgtttcaaacgctgggaatctgagcgcatcctctccttcatccctcctgatggaaacttccgcctgctgtcttaccatgtcagtgcacagaaatgctgtcttgggatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - AU RNA binding protein/enoyl-Coenzyme A hydratase - family with sequence similarity 151, member A - family with sequence similarity 100, member A - family with sequence similarity 105, member B |