ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene View larger

ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024221
Product type: DNA & cDNA
Ncbi symbol: ATG3
Origin species: Human
Product name: ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC024221
Gene id: 64422
Gene description: ATG3 autophagy related 3 homolog (S. cerevisiae)
Synonyms: ATG3 autophagy related 3 homolog; ubiquitin-like-conjugating enzyme ATG3; APG3; APG3-LIKE; APG3L; PC3-96; 2610016C12Rik; APG3 autophagy 3-like; autophagy-related protein 3; hApg3; autophagy related 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaatgtgattaatactgtgaagggaaaggcactggaagtggctgagtacctgaccccggtcctcaaggaatcaaagtttaaggaaacaggtgtaattaccccagaagagtttgtggcagctggagatcacctagtccaccactgtccaacatggcaatgggctacaggggaagaattgaaagtgaaggcatacctaccaacaggcaaacaatttttggtaaccaaaaatgtgccgtgctataagcggtgcaaacagatggaatattcagatgaattggaagctatcattgaagaagatgatggtgatggcggatgggtagatacatatcacaacacaggtattacaggaataacggaagccgttaaagagatcacactggaaaataaggacaatataaggcttcaagattgctcagcactatgtgaagaggaagaagatgaagatgaaggagaagctgcagatatggaagaatatgaagagagtggattgttggaaacagatgaggctaccctagatacaaggaaaatagtagaagcttgtaaagccaaaactgatgctggcggtgaagatgctattttgcaaaccagaacttatgacctttacatcacttatgataaatattaccagactccacgattatggttgtttggctatgatgagcaacggcagcctttaacagttgagcacatgtatgaagacatcagtcaggatcatgtgaagaaaacagtgaccattgaaaatcaccctcatctgccaccacctcccatgtgttcagttcacccatgcaggcatgctgaggtgatgaagaaaatcattgagactgttgcagaaggagggggagaacttggagttcatatgtatcttcttattttcttgaaatttgtacaagctgtcattccaacaatagaatatgactacacaagacacttcacaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - purinergic receptor P2Y, G-protein coupled, 12
- family with sequence similarity 110, member B
- adaptor-related protein complex 4, mu 1 subunit
- patatin-like phospholipase domain containing 4

Buy ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene now

Add to cart