Login to display prices
Login to display prices
ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene View larger

ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene

PTXBC024221

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC024221
Ncbi symbol: ATG3
Product name: ATG3-ATG3 autophagy related 3 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC024221
Gene id: 64422
Gene description: ATG3 autophagy related 3 homolog (S. cerevisiae)
Synonyms: ATG3 autophagy related 3 homolog; ubiquitin-like-conjugating enzyme ATG3; APG3; APG3-LIKE; APG3L; PC3-96; 2610016C12Rik; APG3 autophagy 3-like; autophagy-related protein 3; hApg3; autophagy related 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaatgtgattaatactgtgaagggaaaggcactggaagtggctgagtacctgaccccggtcctcaaggaatcaaagtttaaggaaacaggtgtaattaccccagaagagtttgtggcagctggagatcacctagtccaccactgtccaacatggcaatgggctacaggggaagaattgaaagtgaaggcatacctaccaacaggcaaacaatttttggtaaccaaaaatgtgccgtgctataagcggtgcaaacagatggaatattcagatgaattggaagctatcattgaagaagatgatggtgatggcggatgggtagatacatatcacaacacaggtattacaggaataacggaagccgttaaagagatcacactggaaaataaggacaatataaggcttcaagattgctcagcactatgtgaagaggaagaagatgaagatgaaggagaagctgcagatatggaagaatatgaagagagtggattgttggaaacagatgaggctaccctagatacaaggaaaatagtagaagcttgtaaagccaaaactgatgctggcggtgaagatgctattttgcaaaccagaacttatgacctttacatcacttatgataaatattaccagactccacgattatggttgtttggctatgatgagcaacggcagcctttaacagttgagcacatgtatgaagacatcagtcaggatcatgtgaagaaaacagtgaccattgaaaatcaccctcatctgccaccacctcccatgtgttcagttcacccatgcaggcatgctgaggtgatgaagaaaatcattgagactgttgcagaaggagggggagaacttggagttcatatgtatcttcttattttcttgaaatttgtacaagctgtcattccaacaatagaatatgactacacaagacacttcacaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: