> >>RGS5-regulator of G-protein signaling 5 Gene
RGS5-regulator of G-protein signaling 5 Gene View larger

RGS5-regulator of G-protein signaling 5 Gene

PTXBC030059

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of RGS5-regulator of G-protein signaling 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS5-regulator of G-protein signaling 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030059
Product type: DNA & cDNA
Ncbi symbol: RGS5
Origin species: Human
Product name: RGS5-regulator of G-protein signaling 5 Gene
Size: 2ug
Accessions: BC030059
Gene id: 8490
Gene description: regulator of G-protein signaling 5
Synonyms: MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129; regulator of G-protein signaling 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaaaggacttgcagctttgccccactcatgcctggaaagggccaaggagattaagatcaagttgggaattctcctccagaagccagactcagttggtgaccttgtcattccgtacaatgagaagccagagaaaccagccaagacccagaaaacctcgctggacgaggccctgcagtggcgtgattccctggacaaactcctgcagaacaactatggacttgccagtttcaaaagtttcctgaagtctgaattcagtgaggaaaaccttgagttctggattgcctgtgaggattacaagaagatcaagtcccctgccaagatggctgagaaggcaaagcaaatttatgaagaattcattcaaacggaggctcctaaagaggtgaatattgaccacttcactaaggacatcacaatgaagaacctggtggaaccttccctgagcagctttgacatggcccagaaaagaatccatgccctgatggaaaaggattctctgcctcgctttgtgcgctctgagttttatcaggagttaatcaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB20, member RAS oncogene family
- 4-hydroxyphenylpyruvate dioxygenase
- GTP-binding protein 8 (putative)
- GTP binding protein 5 (putative)

Reviews

Buy RGS5-regulator of G-protein signaling 5 Gene now

Add to cart