PTXBC030059
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC030059 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | RGS5 | 
| Origin species: | Human | 
| Product name: | RGS5-regulator of G-protein signaling 5 Gene | 
| Size: | 2ug | 
| Accessions: | BC030059 | 
| Gene id: | 8490 | 
| Gene description: | regulator of G-protein signaling 5 | 
| Synonyms: | MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129; regulator of G-protein signaling 5 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgtgcaaaggacttgcagctttgccccactcatgcctggaaagggccaaggagattaagatcaagttgggaattctcctccagaagccagactcagttggtgaccttgtcattccgtacaatgagaagccagagaaaccagccaagacccagaaaacctcgctggacgaggccctgcagtggcgtgattccctggacaaactcctgcagaacaactatggacttgccagtttcaaaagtttcctgaagtctgaattcagtgaggaaaaccttgagttctggattgcctgtgaggattacaagaagatcaagtcccctgccaagatggctgagaaggcaaagcaaatttatgaagaattcattcaaacggaggctcctaaagaggtgaatattgaccacttcactaaggacatcacaatgaagaacctggtggaaccttccctgagcagctttgacatggcccagaaaagaatccatgccctgatggaaaaggattctctgcctcgctttgtgcgctctgagttttatcaggagttaatcaagtag | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - RAB20, member RAS oncogene family - 4-hydroxyphenylpyruvate dioxygenase - GTP-binding protein 8 (putative) - GTP binding protein 5 (putative) |