Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELK4-ELK4, ETS-domain protein (SRF accessory protein 1) Gene
PTXBC063676
New product
Data sheet of ELK4-ELK4, ETS-domain protein (SRF accessory protein 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELK4-ELK4, ETS-domain protein (SRF accessory protein 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063676 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELK4 |
| Origin species: | Human |
| Product name: | ELK4-ELK4, ETS-domain protein (SRF accessory protein 1) Gene |
| Size: | 2ug |
| Accessions: | BC063676 |
| Gene id: | 2005 |
| Gene description: | ELK4, ETS-domain protein (SRF accessory protein 1) |
| Synonyms: | ELK4, ETS transcription factor; ELK4, ETS-domain protein (SRF accessory protein 1); SAP1; ETS domain-containing protein Elk-4; SAP-1; serum response factor accessory protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagtgctatcaccctgtggcagttccttcttcagctcctgcagaagcctcagaacaagcacatgatctgttggacctctaatgatgggcagtttaagcttttgcaggcagaagaggtggctcgtctctgggggattcgcaagaacaagcctaacatgaattatgacaaactcagccgagccctcagatactattatgtaaagaatatcatcaaaaaagtgaatggtcagaagtttgtgtacaagtttgtctcttatccagagattttgaacatggatccaatgacagtgggcaggattgagggtgactgtgaaagtttaaacttcagtgaagtcagcagcagttccaaagatgtggagaatggagggaaagataaaccacctcagcctggtgccaagacctctagccgcaatgactacatacactctggcttatattcttcatttactctcaactctttgaactcctccaatgtaaagcttttcaaattgataaagactgagaatccagccgagaaactggcagagaaaaaatctcctcaggagcccacaccatctgtcatcaaatttgtcacgacaccttccaaaaagccaccggttgaacctgttgctgccaccatttcaattggcccaagtatttctccatcttcagaagaaactatccaagctttggagacattggtttccccaaaactgccttccctggaagccccaacctctgcctctaacgtaatgactgcttttgccaccacaccacccatttcgtccataccccctttgcaggaacctcccagaacaccttcaccaccactgagttctcacccagacatcgacacagacattgattcagtggcttctcagccaatggaacttccagagaatttgtcactggagcctaaagaccaggattcagtcttgctagaaaaggacaaagtaaataattcatcaagatccaagaaacccaaagggttagaactggcacccacccttgtgatcacgagcagtgatccaagcccactgggaatactgagcccatctctccctacagcttctcttacaccagcatttttttcacaggtagcttgctcgctctttatggtgtcaccattgctttcatttatttgcccttttaagcaaatccagaatttatacactcaagtttgctttctgttacttaggtttgtcttagaaaggttatgtgtgactgtcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - retinol dehydrogenase 11 (all-trans/9-cis/11-cis) - RNA pseudouridylate synthase domain containing 3 - fumarylacetoacetate hydrolase domain containing 1 - centrobin, centrosomal BRCA2 interacting protein |