Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ANXA4-annexin A4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANXA4-annexin A4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063672 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANXA4 |
| Origin species: | Human |
| Product name: | ANXA4-annexin A4 Gene |
| Size: | 2ug |
| Accessions: | BC063672 |
| Gene id: | 307 |
| Gene description: | annexin A4 |
| Synonyms: | ANX4; HEL-S-274; P32.5; PAP-II; PIG28; PP4-X; ZAP36; annexin A4; 35-beta calcimedin; annexin IV (placental anticoagulant protein II); annexin-4; carbohydrate-binding protein p33/p41; chromobindin-4; endonexin I; epididymis secretory protein Li 274; lipocortin IV; placental anticoagulant protein II; proliferation-inducing gene 28; proliferation-inducing protein 28; protein II |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccatggcaaccaaaggaggtactgtcaaagctgcttcaggattcaatgccatggaagatgcccagaccctgaggaaggccatgaaagggctcggcaccgatgaagacgccattattagcgtccttgcctaccgcaacaccgcccagcgccaggagatcaggacagcctacaagagcaccatcggcagggacttgatagacgacctgaagtcagaactgagtggcaacttcgagcagggagccggcactgatgagggctgcctaattgagatcctggcctcccggacccctgaggagatccggcgcataagccaaacctaccagcagcaatatggacggagccttgaagatgacattcgctctgacacatcgttcatgttccagcgagtgctggtgtctctgtcagctggtgggagggatgaaggaaattatctggacgatgctctcgtgagacaggatgcccaggacctgtatgaggctggagagaagaaatgggggacagatgaggtgaaatttctaactgttctctgttcccggaaccgaaatcacctgttgcatgtgtttgatgaatacaaaaggatatcacagaaggatattgaacagagtattaaatctgaaacatctggtagctttgaagatgctctgctggctatagtaaagtgcatgaggaacaaatctgcatattttgctgaaaagctctataaatcgatgaagggcttgggcaccgatgataacaccctcatcagagtgatggtttctcgagcagaaattgacatgttggatatccgggcacacttcaagagactctatggaaagtctctgtactcgttcatcaagggtgacacatctggagactacaggaaagtactgcttgttctctgtggaggagatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - annexin A2 - aftiphilin - aquaporin 9 - annexin A1 |