ANXA2-annexin A2 Gene View larger

ANXA2-annexin A2 Gene

PTXBC023990

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANXA2-annexin A2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANXA2-annexin A2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023990
Product type: DNA & cDNA
Ncbi symbol: ANXA2
Origin species: Human
Product name: ANXA2-annexin A2 Gene
Size: 2ug
Accessions: BC023990
Gene id: 302
Gene description: annexin A2
Synonyms: ANX2; ANX2L4; CAL1H; HEL-S-270; LIP2; LPC2; LPC2D; P36; PAP-IV; annexin A2; annexin-2; calpactin I heavy chain; calpactin I heavy polypeptide; calpactin-1 heavy chain; chromobindin 8; epididymis secretory protein Li 270; lipocortin II; placental anticoagulant protein IV; protein I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctactgttcacgaaatcctgtgcaagctcagcttggagggtgatcactctacacccccaagtgcatatgggtctgtcaaagcctatactaactttgatgctgagcgggatgctttgaacattgaaacagccatcaagaccaaaggtgtggatgaggtcaccattgtcaacattttgaccaaccgcagcaatgcacagagacaggatattgccttcgcctaccagagaaggaccaaaaaggaacttgcatcagcactgaagtcagccttatctggccacctggagacggtgattttgggcctattgaagacacctgctcagtatgacgcttctgagctaaaagcttccatgaaggggctgggaaccgacgaggactctctcattgagatcatctgctccagaaccaaccaggagctgcaggaaattaacagagtctacaaggaaatgtacaagactgatctggagaaggacattatttcggacacatctggtgacttccgcaagctgatggttgccctggcaaagggtagaagagcagaggatggctctgtcattgattatgaactgattgaccaagatgctcgggatctctatgacgctggagtgaagaggaaaggaactgatgttcccaagtggatcagcatcatgaccgagcggagcgtgccccacctccagaaagtatttgataggtacaagagttacagcccttatgacatgttggaaagcatcaggaaagaggttaaaggagacctggaaaatgctttcctgaacctggttcagtgcattcagaacaagcccctgtattttgctgatcggctgtatgactccatgaagggcaaggggacgcgagataaggtcctgatcagaatcatggcctcccgcagtgaagtggacatgttgaaaattaggtctgaattcaagagaaagtacggcaagtccctgtactattatatccagcaagacactaagggcgactaccagaaagcgctgctgtacctgtgtggtggagatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aftiphilin
- aquaporin 9
- annexin A1
- aquaporin 4

Buy ANXA2-annexin A2 Gene now

Add to cart