AFTPH-aftiphilin Gene View larger

AFTPH-aftiphilin Gene

PTXBC022247

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AFTPH-aftiphilin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AFTPH-aftiphilin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022247
Product type: DNA & cDNA
Ncbi symbol: AFTPH
Origin species: Human
Product name: AFTPH-aftiphilin Gene
Size: 2ug
Accessions: BC022247
Gene id: 54812
Gene description: aftiphilin
Synonyms: Nbla10388; aftiphilin; aftiphilin protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtatgcagcaggattgggtatgttagagcccaccaaggaaccactgaaaccactttctgctgcagaaaaaatagcttccatcggtcagacagccaccatgtcaccagatatgaacacatgtacatctgatcagttccaggagtctctaccacccgtccagtttgactggagtagcagtggccttactaaccctttagatggtgtggatccggagttgtatgagttaacaacttctaagctggaaatctccacctcaagcctcaaagtgactgatgcatttgcaagactcatgtctacagtagagaagacaagcacatctaccaggaaaccgaaaagagaagggcacctaagtgaagaagctatcaaggtgatcgctggccttcctgacttaacattcatgcatgccaaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aquaporin 9
- annexin A1
- aquaporin 4
- kininogen 1

Reviews

Buy AFTPH-aftiphilin Gene now

Add to cart