Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2M-ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene
PTXBC058924
New product
Data sheet of UBE2M-ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2M-ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058924 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2M |
| Origin species: | Human |
| Product name: | UBE2M-ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC058924 |
| Gene id: | 9040 |
| Gene description: | ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) |
| Synonyms: | UBC-RS2; UBC12; hUbc12; NEDD8-conjugating enzyme Ubc12; NEDD8 carrier protein; NEDD8 protein ligase; ubiquitin carrier protein M; ubiquitin conjugating enzyme E2M; ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast); ubiquitin-protein ligase M; yeast UBC12 homolog; ubiquitin conjugating enzyme E2 M |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcaagctgttctcgctgaagcagcagaagaaggaggaggagtcggcgggcggcaccaagggcagcagcaagaaggcgtcggcggcgcagctgcggatccagaaggacataaacgagctgaacctgcccaagacgtgtgatatcagcttctcagatccagacgacctcctcaacttcaagctggtcatctgtcctgatgagggcttctacaagagtgggaagtttgtgttcagttttaaggtgggccagggttacccgcatgatccccccaaggtgaagtgtgagacaatggtctatcaccccaacattgacctcgagggcaacgtctgcctcaacatcctcagagaggactggaagccagtccttacgataaactccataatttatggcctgcagtatctcttcttggagcccaaccccgaggacccactgaacaaggaggccgcagaggtcctgcagaacaaccggcggctgtttgagcagaacgtgcagcgctccatgcggggtggctacatcggctccacctactttgagcgctgcctgaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 39 (zinc transporter), member 9 - general transcription factor IIH, polypeptide 3, 34kDa - solute carrier family 34 (sodium phosphate), member 1 - SH3 domain binding glutamic acid-rich protein like 3 |