Cart 3 Product Products 629,90 € (empty)
-
1 x APOL4-apol...113,40 € -
1 x RPRD1A-reg...121,50 € -
No products
To be determined Shipping
629,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 629,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 629,90 €
View larger 
SLC39A9-solute carrier family 39 (zinc transporter), member 9 Gene
PTXBC064383
New product
Data sheet of SLC39A9-solute carrier family 39 (zinc transporter), member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A9-solute carrier family 39 (zinc transporter), member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064383 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A9 |
| Origin species: | Human |
| Product name: | SLC39A9-solute carrier family 39 (zinc transporter), member 9 Gene |
| Size: | 2ug |
| Accessions: | BC064383 |
| Gene id: | 55334 |
| Gene description: | solute carrier family 39 (zinc transporter), member 9 |
| Synonyms: | zinc transporter SLC39A9; ZIP-9; ZIP9; zinc transporter ZIP9; solute carrier family 39 (zinc transporter), member 9; zrt- and Irt-like protein 9; solute carrier family 39 member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgatttcatctccattagcctgctgtctctggctatgttggtgggatgttacgtggccggaatcattcccttggctgttaatttctcagaggaacgactgaagctggtgactgttttgggtgctggccttctctgtggaactgctctggcagtcatcgtgcctgaaggagtacatgccctttatgaagatattcttgagggaaaacaccaccaagcaagtgaaacacataatgtgattgcatcagacaaagcagcagaaaaatcagttgtccatgaacatgagcacagccacgaccacacacagctgcatgcctatattggtgtttccctcgttctgggcttcgttttcatgttgctggtggaccagattggtaactcccatgtgcattctactgacgatccagaagcagcaaggtctagcaattccaaaatcaccaccacgctgggtctggttgtccatgctgcagctgatggtgttgctttgggagcagcagcatctacttcacagaccagtgtccagttaattgtgtttgtggcaatcatgctacataaggcaccagctgcttttggactggtttccttcttgatgcatgctggcttagagcggaatcgaatcagaaagcacttgctggtctttgcattggcagcaccagttatgtccatggtgacatacttaggactgagtaagagcagtaaagaagccctttcagaggtgaacgccacgggagtggccatgcttttctctgccgggacatttctttatgttgccacagtacatgtcctccctgaggtgggcggaatagggcacagccacaagcccgatgccacgggagggagaggcctcagctgcctggaagtggcagccctggttctgggttgcctcatccctctcatcctgtcagtaggacaccagcattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIH, polypeptide 3, 34kDa - solute carrier family 34 (sodium phosphate), member 1 - SH3 domain binding glutamic acid-rich protein like 3 - twinfilin, actin-binding protein, homolog 1 (Drosophila) |