Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GTF2H3-general transcription factor IIH, polypeptide 3, 34kDa Gene
PTXBC065250
New product
Data sheet of GTF2H3-general transcription factor IIH, polypeptide 3, 34kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF2H3-general transcription factor IIH, polypeptide 3, 34kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF2H3 |
| Origin species: | Human |
| Product name: | GTF2H3-general transcription factor IIH, polypeptide 3, 34kDa Gene |
| Size: | 2ug |
| Accessions: | BC065250 |
| Gene id: | 2967 |
| Gene description: | general transcription factor IIH, polypeptide 3, 34kDa |
| Synonyms: | BTF2; P34; TFB4; TFIIH; general transcription factor IIH subunit 3; TFIIH basal transcription factor complex p34 subunit; basic transcription factor 2 34 kDa subunit; general transcription factor IIH, polypeptide 3, 34kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtttcagacgaagatgaattgaatcttctggttattgtagttgatgccaacccaatttggtggggaaagcaagcattaaaggaatctcagttcactttatccaaatgcatagatgccgtgatggtgctgggaaattcgcatttattcatgaatcgttccaacaaacttgctgtgatagcaagtcacattcaagaaagccgattcttatatcctggaaagaatggcagacttggagacttcttcggagaccctggcaaccctcctgaatttaatccctctgggagtaaagatggaaaatacgaacttttaacctcagcaaatgaagttattgttgaagagattaaagatctaatgaccaaaagtgacataaagggtcaacatacagaaactttgctggcaggatccctggccaaagccctttgctacattcatagaatgaacaaggaagttaaagacaatcaggaaatgaaatcaaggatattggtgattaaggctgcagaagacagtgcgttgcagtatatgaacttcatgaatgtcatctttgcagcacagaaacagaatattttgattgatgcctgtgttttagactccgactcagggctcctccaacaggcttgtgacatcacgggaggactgtacctgaaggtgcctcagatgccttctcttctgcagtatttgctgtgggtgtttcttcccgatcaagatcagagatctcagttaatcctcccacccccggttcatgttgactacagggctgcttgcttctgtcatcgaaatctcattgaaattggttatgtctgttctgtgtgtttgtcaatattctgcaatttcagccccatttgtactacgtgcgagacagcctttaaaatttctctgcctccagtgctgaaagccaagaaaaagaaactgaaagtgtctgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 34 (sodium phosphate), member 1 - SH3 domain binding glutamic acid-rich protein like 3 - twinfilin, actin-binding protein, homolog 1 (Drosophila) - serine palmitoyltransferase, long chain base subunit 3 |