Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DSCR9-Down syndrome critical region gene 9 (non-protein coding) Gene
PTXBC066653
New product
Data sheet of DSCR9-Down syndrome critical region gene 9 (non-protein coding) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DSCR9-Down syndrome critical region gene 9 (non-protein coding) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066653 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DSCR9 |
| Origin species: | Human |
| Product name: | DSCR9-Down syndrome critical region gene 9 (non-protein coding) Gene |
| Size: | 2ug |
| Accessions: | BC066653 |
| Gene id: | 257203 |
| Gene description: | Down syndrome critical region gene 9 (non-protein coding) |
| Synonyms: | NCRNA00038; Down syndrome critical region gene 9 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaggatttgccccgtgaactcccgcgcacgcaggctccgcgcgaggcccgggcgcccgagcggcgattccctcccctatcaccagctccagggtggtgccccccggctgtggagcccagaccccggccgtccagcagcgtatagacgagcccatgtctgcgatgtaactgcaccgcgctggggatccacctcccgccagggtgagggcgccgtcctccagcgtatgctaggcaggcgcgccccgccctcctggtcacgtgaccacgcctacagccgaagaggatgggaaaatgcggccctgttcctgaacaggaagcggaagcaggaaggaactgagaacaccagcatctgctgccgccctgaatcagcgttagcatgtggaggcaacctcagcccccagtttttgaagaaggtgattcagattcagacacaggaattatggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - COX assembly mitochondrial protein homolog (S. cerevisiae) - alanyl-tRNA synthetase domain containing 1 pseudogene - protein kinase (cAMP-dependent, catalytic) inhibitor alpha - receptor (G protein-coupled) activity modifying protein 3 |